BAC-221110FOR-2
Library B (Q19, Q23, Q24, Q26, Q27, Q28)
Sarah Fortune
Not specified
Not specified
Not specified
Mycobacterium tuberculosis
Not specified
Bacillus
Not specified
Erdman
652616.0
Positive
NNNNNNN
ACGCGTCAGTGAAA; CTCCACTCCAGCTG; ATCGCCTCCTTCCG; TCTTCTACAACAACCCGCTGCTGTCGTTACGCCGCCTCCTTGGATTCGACGACGGACATGGCGTAGTCGTGCATGC; AGCACGCCTTGTCCAAGAACCAGTGCACACGTTTCCGTCACGGATCATCGTTCTTCCAGCTCACGGGCTG; AGCGACTCCACGATCCGACTAGCAATGCATCCTGTTTGGCATCGGCAGTGATGGAGTAGCACCCTTGGTG
Creators and SubmitterViews: 5
Created: 20th Oct 2025 at 15:58
TagsThis item has not yet been tagged.
AttributionsNone
Related items
Projects: Hi-IMPAcTB, MIT SRP, MetNet, Endometriosis, Cancer Systems Biology Consortium (CSBC), Shoulders Lab
Institutions: Massachusetts Institute of Technology
Projects: MIT SRP, Hi-IMPAcTB, MetNet, Endometriosis, Cancer Systems Biology Consortium (CSBC), Shoulders Lab
Web page: https://nextseek.mit.edu/
Endometriosis research done by the Griffith lab (MIT) and the Goods lab (Dartmouth)
Programme: NExtSEEK
Public web page: Not specified
ABSTRACT – OVERALL The primary focus of the MIT/DFCI Center for Systems Biology of Glioblastoma is to understand the intersections between neurons, immune cells, and tumor cells in this deadly tumor. The lack of response to immunotherapy strategies despite prominent infiltrates of immune cells in many GBM highlights the immuno- suppressive nature of the GBM microenvironment and the importance of more clearly understanding the dynamic interactions at the tumor/immune interface. Similarly, interactions ...
Programme: NExtSEEK
Public web page: Not specified
Understanding the spectrum of complex metastatic processes is important to the development of a comprehensive and cohesive understanding of cancer metastasis. The Metastasis Research Network (MetNet) supports collaborative, multidisciplinary projects that focus on several themes of the metastatic process and use integrative systems-level approaches.
MetNet is advancing the understanding of metastasis as a non-linear, dynamic, and emergent process, as well as revealing mechanistic insights of early ...
Programme: NExtSEEK
Public web page: Not specified
The MIT Superfund Research Program was created in 2017 to be responsive to communities who live near Superfund Sites. In particular, the MIT team leverages scientific research, community engagement, and educational experiences to support people who are concerned about hazardous chemicals in their environment.
Carcinogenic contaminants threaten the health of people living in the Mystic River Watershed (near the Olin, Industriplex, and Wells G&H Superfund sites) and members of Native American ...
Programme: NExtSEEK
Public web page: Not specified
About
This project houses all the publicly available datasets generated by the Hi-IMPAcTB consortium over the course of its 7+ years.
What is Hi-IMPAcTB?
Hi-IMPAcTB is an ambitious endeavor bringing together a team of international, interdisciplinary researchers to improve our understanding of host-pathogen interactions in the context of tuberculosis (TB). Funded by a multi-center contract from the NIH, the long-term goal of the consortium is to enable principled vaccine design by improving ...
Programme: NExtSEEK
Public web page: https://grantome.com/grant/NIH/75N93019C00071-0-9999-1
Submitter: Dikshant Pradhan
Studies: Abiola Placeholder, Age and sex influence antibody profiles associated with tuberculosis pro..., Antibody-Fab and -Fc features promote Mycobacterium tuberculosis restric..., CD4+ T cells re-wire granuloma cellularity and regulatory networks to pr..., CD8+ lymphocytes are critical for early control of tuberculosis in macaques, Comparable Non-canonical T cell responses are associated with protection..., Fc-engineered antibodies leverage neutrophils to drive control of Mycoba..., Fc-engineered monoclonal antibodies drive antibody-dependent enhancement..., High-dose intravenous BCG vaccination induces enhanced immune signaling ..., Humoral correlates of protection against Mycobacterium tuberculosis foll..., Immune cells in bronchoalveolar lavage fluid of Ugandan adults who resis..., Intravenous BCG-mediated protection against tuberculosis requires CD4+ T..., Mike Chao Barcoding Placeholder, Multi-modal data integration using Markov Field graphical networks predi..., Multimodal profiling of lung granulomas in macaques reveals cellular cor..., Protection against reinfection with Mycobacterium tuberculosis extends a..., Robust IgM responses following intravenous vaccination with Bacille Calm..., Specific CD4+ T cell phenotypes associate with bacterial control in peop..., Systematic deconstruction of myeloid cell signaling in tuberculosis gran..., Systems-level computational translation of mouse and human transcriptomi...
Assays: ADCD Analysis - Data Linked, ADFP Analysis - Data Linked, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, Anti-Microbial Assay – Metadata, Antibody Challenge - Metadata, Antibody Dependent Complement Deposition - Data Linked, Antibody Dependent Functional Profiling - Data Linked, Antibody Titer - Data Linked, Antibody Titer Analysis - Data Linked, Antibody-Dependent Cellular Phagocytosis - Data Linked, Antibody-Dependent Cellular Phagocytosis - Data Linked, Antibody-Dependent Cellular Phagocytosis Analysis - Data Linked, Antibody-Dependent NK Cell Activation - Data Linked, Antibody-Dependent NK Cell Activation Analysis - Data Linked, Antibody-Dependent Neutrophil Phagocytosis - Data Linked, Antibody-Dependent Neutrophil Phagocytosis - Data Linked, Antibody-Dependent Neutrophil Phagocytosis Analysis - Data Linked, Antibody-dependent Cellular Phagocytosis - Data Linked, Antibody-dependent Complement Deposition - Data Linked, Antibody-dependent NK Cell Activation - Data Linked, Antibody-dependent Neutrophil Phagocytosis - Data Linked, Bacterial Challenge - Metadata, Bacterial Extraction - Metadata, Bacterial Extraction - Metadata, Bacterial Extraction - Metadata, Bacterial Extraction - Metadata, Bacterial Survivability Restriction Assay - Data Linked, Bacterial Survivability Restriction Assay - Data Linked, Bacterial Survivability Restriction Assay: Validation Data - Data Attached, CITESEQ Analysis - Data Linked, Cell Extraction - Metadata, Cell Extraction: Validation Data - Metadata, Cell Isolation - Metadata, Cell Isolation - Metadata, Cell Sorting – Data Linked, DNA Extraction - Metadata, Digitally Barcoded Mtb Matrix Analysis - Data Attached, Digitally Barcoded Mtb Matrix Analysis - Data Attached, Digitally Barcoded Mtb Matrix Analysis - Data Attached, Digitally Barcoded Mtb Matrix Analysis - Data Linked, ELISA - Data Linked, ELISA Assay - Data Linked, FC Receptor Binding - Data Linked, FC Receptor Binding Analysis - Data Linked, FC Receptor Binding Assay - Data Linked, FC-Receptor Binding Assay - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry Analysis - Data Attached, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Processing – Data Attached, Flow Cytometry – Data Linked, Functional Assay – Metadata, Gene Expression Analysis - Data Linked, Gene Expression Analysis: Training Data - Data Linked, Gene Expression Analysis: Validation Data - Data Linked, Glycosylation Assay - Data Linked, Histology - Data Linked, Immunohistochemistry - Data Linked, Immunohistochemistry - Data Linked, Immunohistochemistry – Data Linked, Library Creation - Metadata, Library Creation - Metadata, Library Creation - Metadata, Library Creation – Metadata, Library Prep - Metadata, Library Prep - Metadata, Library Prep - Metadata, Library Prep - Metadata, Library Prep - Metadata, Library Prep: Training Data - Metadata, Library Prep: Validation Data - Metadata, Linear Mixed Model - Data Linked, Luminex - Data Linked, Luminex Assay – Metadata, Luminex Data Processing – Data Attached, Mass Cytometry - Data Linked, Mass Cytometry Analysis - Data Linked, Model Validation, Model Validation - Data Linked, Mouse Challenge – Metadata, NHP Necropsy – Metadata, NHP Tissue Collection – Metadata, PCR: Validation Data - Data Attached, PET-CT Scan - Data Linked, PET-CT Scan - Data Linked, PET-CT Scan - Data Linked, PET-CT Scan Analysis – Data Linked, PET-CT Scan – Data Linked, PET/CT Scan - Data Linked, PET/CT Scan - Data Linked, Pathogen Challenge and Antibody Depletion - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit – Metadata, Patient Visit – Metadata, RNA Extraction: Validation Data - Metadata, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing: Training Data - Data Linked, Short Read Sequencing: Validation Data - Data Linked, Single Cell Clustering - Data Linked, Single Cell Clustering Analysis - Data Linked, Single Cell Clustering Analysis – Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Matrix Analysis – Data Linked, Single Cell Sequencing – Data Linked, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection – Metadata, Tissue Collection: Training Data - Metadata, Tissue Extraction - Metadata, Titer Assay - Data Linked, Titer Assay - Data Linked, Titer Assay Analysis - Data Linked, TransCompR Cross Species Modeling - Data Linked, Western Blot - Data Linked
Andrew W Simonson, Michael C Chao, Luke E Hood, Rachel A Donlan, Forrest Hopkins, Michael R Chase, Andrew J Vickers, Alanna Callendrello, Edwin Klein, H Jacob Borish, Marshall Malin, Pauline Maiello, Charles A Scanga, Philana Ling Lin, Sarah M Fortune, JoAnne L Flynn
DOI: https://doi.org/10.1101/2025.07.08.663727
Immunological memory elicited either through previous or ongoing M. tuberculosis (Mtb) infection provides a critical mechanism by which hosts protect ...
Submitter: Charles Demurjian
Investigation: IMPAcTB
Assays: All Metadata, Bacterial Extraction - Metadata, Digitally Barcoded Mtb Matrix Analysis - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry Analysis - Data Linked, Library Prep - Metadata, PET-CT Scan - Data Linked, Patient Visit - Metadata, Short Read Sequencing - Data Linked, Tissue Collection - Metadata
Submitter: Charles Demurjian
Assay type: Experimental Assay Type
Technology type: Technology Type
Investigation: IMPAcTB
