samples-publishJB_CD4_BAC.xlsx
Library A (Q19, Q23, Q24)
Sarah Fortune
Mycobacterium tuberculosis
Bacillus
Erdman
652616
Positive
NNNNNNN
AGGAACACCAAGACCACGACGAGCAGGATGGAAGCGGGAATCAGGGCGTTCATGCAGCAGCTGGAGTGGAGGCATGC; CGAGCGCGAGGAGGTGGTACTTGATCTTTTGCCATGCTCGCCTCCACAGAACAAGAGCGGAAGGAGGCGATGCATGC; TGGCGAATATGGCGGCTTACAACAACCGCAGCAACCCGTGCTTCAGCGCTGAACCAAGCTGCAGAACTTGAGCATGC
Views: 34
Created: 16th Jul 2024 at 18:58
This item has not yet been tagged.
None
Related items
- People (1)
- Programmes (1)
- Projects (1)
- Investigations (1)
- Studies (1)
- Assays (1)
- Data files (1)
- Sample types (1)
Projects: Hi-IMPAcTB, MIT SRP, MetNet, Endometriosis, Cancer Systems Biology Consortium (CSBC)
Institutions: Massachusetts Institute of Technology
Projects: Hi-IMPAcTB
Web page: https://www.niaid.nih.gov/research/immune-mechanisms-protection-mycobacterium-tuberculosis
About
This project houses all the publicly available datasets generated by the Hi-IMPAcTB consortium over the course of its 7+ years.
What is Hi-IMPAcTB?
Hi-IMPAcTB is an ambitious endeavor bringing together a team of international, interdisciplinary researchers to improve our understanding of host-pathogen interactions in the context of tuberculosis (TB). Funded by a multi-center contract from the NIH, the long-term goal of the consortium is to enable principled vaccine design by improving ...
Programme: IMPAcTB
Public web page: https://grantome.com/grant/NIH/75N93019C00071-0-9999-1
Organisms: Mus musculus, Homo sapiens, Macaca fascicularis, Macaca mulatta
Submitter: Dikshant Pradhan
Studies: Age and sex influence antibody profiles associated with tuberculosis pro..., CD4+ T cells re-wire granuloma cellularity and regulatory networks to pr..., CD8+ lymphocytes are critical for early control of tuberculosis in macaques, Fc-FcγR interactions shift alveolar macrophage metabolism to promote Myc..., Fc-engineered antibodies leverage neutrophils to drive control of Mycoba..., Humoral correlates of protection against Mycobacterium tuberculosis foll..., Immune cells in bronchoalveolar lavage fluid of Ugandan adults who resis..., Multi-modal data integration using Markov Field graphical networks predi..., Multimodal profiling of lung granulomas in macaques reveals cellular cor..., Protective intravenous BCG vaccination induces enhanced immune signaling..., Robust IgM responses following intravenous vaccination with Bacille Calm..., Specific CD4+ T cell phenotypes associate with bacterial control in peop...
Assays: All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, Anti-Microbial Assay – Metadata, Antibody Challenge - Metadata, Antibody Titer - Data Linked, Antibody Titer Analysis - Data Linked, Antibody-Dependent Cellular Phagocytosis - Data Linked, Antibody-Dependent Cellular Phagocytosis - Data Linked, Antibody-Dependent Cellular Phagocytosis Analysis - Data Linked, Antibody-Dependent NK Cell Activation - Data Linked, Antibody-Dependent NK Cell Activation Analysis - Data Linked, Antibody-Dependent Neutrophil Phagocytosis - Data Linked, Antibody-Dependent Neutrophil Phagocytosis - Data Linked, Antibody-Dependent Neutrophil Phagocytosis Analysis - Data Linked, Antibody-dependent Cellular Phagocytosis - Data Linked, Antibody-dependent Complement Deposition - Data Linked, Antibody-dependent NK Cell Activation - Data Linked, Antibody-dependent Neutrophil Phagocytosis - Data Linked, Bacterial Challenge - Metadata, Bacterial Extraction - Metadata, Bacterial Extraction - Metadata, Bacterial Survivability Restriction Assay - Data Linked, DNA Extraction - Metadata, Digitally Barcoded Mtb Matrix Analysis - Data Attached, Digitally Barcoded Mtb Matrix Analysis - Data Attached, ELISA - Data Linked, FC Receptor Binding - Data Linked, FC Receptor Binding Analysis - Data Linked, FC Receptor Binding Assay - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry Analysis - Data Attached, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Processing – Data Attached, Flow Cytometry – Data Linked, Functional Assay – Metadata, Glycosylation Assay - Data Linked, Immunohistochemistry - Data Linked, Immunohistochemistry – Data Linked, Library Creation - Metadata, Library Creation – Metadata, Library Prep - Metadata, Library Prep - Metadata, Linear Mixed Model - Data Linked, Luminex - Data Linked, Luminex Assay – Metadata, Luminex Data Processing – Data Attached, Model Validation, NHP Necropsy – Metadata, NHP Tissue Collection – Metadata, PET-CT Scan - Data Linked, PET-CT Scan Analysis – Data Linked, PET-CT Scan – Data Linked, PET/CT Scan - Data Linked, PET/CT Scan - Data Linked, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit – Metadata, Patient Visit – Metadata, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Single Cell Clustering Analysis - Data Linked, Single Cell Clustering Analysis – Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Matrix Analysis – Data Linked, Single Cell Sequencing Analysis – Data Linked, Single Cell Sequencing – Data Linked, Single Cell Sequencing – Data Linked, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Extraction - Metadata, Tissue Extraction – Metadata, Titer Assay - Data Linked, Titer Assay - Data Linked, Titer Assay Analysis - Data Linked
Snapshots: No snapshots
Joshua D. Bromley, Sharie Keanne C. Ganchua, Sarah K. Nyquist, Pauline Maiello, Michael Chao, H. Jacob Borish, Mark Rodgers, Jaime Tomko, Kara Kracinovsky, Douaa Mugahid, Son Nguyen, Dennis Wang, Jacob M. Rosenberg, Edwin C. Klein, Hannah P. Gideon, Roisin Floyd-O’Sullivan, Bonnie Berger, Charles A Scanga, Philana Ling Lin, Sarah M. Fortune, Alex K. Shalek, JoAnne L. Flynn
Link to Paper: https://www.cell.com/immunity/fulltext/S1074-7613(24)00375-3
Immunological ...
Submitter: Charles Demurjian
Investigation: IMPAcTB
Assays: All Metadata, Bacterial Extraction - Metadata, Digitally Barcoded Mtb Matrix Analysis - Data Attached, Flow Cytometry - Data Linked, Flow Cytometry Analysis - Data Linked, Library Prep - Metadata, PET-CT Scan - Data Linked, Patient Visit - Metadata, Short Read Sequencing - Data Linked, Single Cell Expression Analysis - Data Linked, Tissue Collection - Metadata
Snapshots: No snapshots
Submitter: Charles Demurjian
Assay type: Experimental Assay Type
Technology type: Technology Type
Investigation: IMPAcTB
Organisms: No organisms
SOPs: P.FLY-240716_V1_CD4_NHPs.docx, P.FLY-240716_V1_CD4_NX_Procedure.docx
Data files: CD4-Depletion-Reinfection Study Design Graphic, samples-publishJB_CD4_AB.xlsx, samples-publishJB_CD4_BAC.xlsx, samples-publishJB_CD4_NHP.xlsx, samples-publishJB_CD4_PAV.xlsx
Snapshots: No snapshots
Batch sample publishing
Creator: Charles Demurjian
Submitter: Charles Demurjian
Investigations: IMPAcTB
Studies: CD4+ T cells re-wire granuloma cellularity and ...
Assays: Patient Visit - Metadata