BAC-samples-publish2023-10-11_13-48.xlsx No longer valid
Library B (Q19, Q23, Q24, Q26, Q27, Q28)
Sarah Fortune
Mycobacterium tuberculosis
Bacillus
Erdman
652616
Positive
NNNNNNN
ACGCGTCAGTGAAA; CTCCACTCCAGCTG; ATCGCCTCCTTCCG; TCTTCTACAACAACCCGCTGCTGTCGTTACGCCGCCTCCTTGGATTCGACGACGGACATGGCGTAGTCGTGCATGC; AGCACGCCTTGTCCAAGAACCAGTGCACACGTTTCCGTCACGGATCATCGTTCTTCCAGCTCACGGGCTG; AGCGACTCCACGATCCGACTAGCAATGCATCCTGTTTGGCATCGGCAGTGATGGAGTAGCACCCTTGGTG
Creators and SubmitterViews: 317
Created: 11th Oct 2023 at 18:26
TagsThis item has not yet been tagged.
AttributionsNone
Related items
- People (1)
- Programmes (1)
- Projects (1)
- Investigations (1)
- Studies (1)
- Assays (1)
- Data files (1)
- Sample types (1)
Projects: MIT SRP, Hi-IMPAcTB, MetNet, Endometriosis, Cancer Systems Biology Consortium (CSBC), Shoulders Lab, NExtSEEK Independent Projects
Web page: https://nextseek.mit.edu/
About
This project houses all the publicly available datasets generated by the Hi-IMPAcTB consortium over the course of its 7+ years.
What is Hi-IMPAcTB?
Hi-IMPAcTB is an ambitious endeavor bringing together a team of international, interdisciplinary researchers to improve our understanding of host-pathogen interactions in the context of tuberculosis (TB). Funded by a multi-center contract from the NIH, the long-term goal of the consortium is to enable principled vaccine design by improving ...
Programme: NExtSEEK
Public web page: https://grantome.com/grant/NIH/75N93019C00071-0-9999-1
Organisms: Mus musculus, Homo sapiens, Macaca fascicularis, Macaca mulatta
Submitter: Dikshant Pradhan
Studies: Age and sex influence antibody profiles associated with tuberculosis pro..., Antibody-Fab and -Fc features promote Mycobacterium tuberculosis restric..., BCG vaccination elicits protection against Mtb infection mediated by two..., BCG vaccination induces antibacterial effector functions among Vδ1/3 T c..., CD4+ T cells re-wire granuloma cellularity and regulatory networks to pr..., CD8+ lymphocytes are critical for early control of tuberculosis in macaques, Comparable Non-canonical T cell responses are associated with protection..., Fc-engineered antibodies leverage neutrophils to drive control of Mycoba..., Fc-engineered monoclonal antibodies drive antibody-dependent enhancement..., High-dose intravenous BCG vaccination induces enhanced immune signaling ..., Humoral correlates of protection against Mycobacterium tuberculosis foll..., IFN-γ- GranzymeB + Natural killer cells are induced by IV BCG vaccinatio..., Immune cells in bronchoalveolar lavage fluid of Ugandan adults who resis..., Intravenous BCG-mediated protection against tuberculosis requires CD4+ T..., Mike Chao Barcoding Placeholder, Multi-modal data integration using Markov Field graphical networks predi..., Multimodal profiling of lung granulomas in macaques reveals cellular cor..., Protection against reinfection with Mycobacterium tuberculosis extends a..., Robust IgM responses following intravenous vaccination with Bacille Calm..., Soloman placeholder, Specific CD4+ T cell phenotypes associate with bacterial control in peop..., Systematic deconstruction of myeloid cell signaling in tuberculosis gran..., Systems-level computational translation of mouse and human transcriptomi...
Assays: ADCD Analysis - Data Linked, ADFP Analysis - Data Linked, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, All Metadata, Anti-Microbial Assay – Metadata, Antibody Challenge - Metadata, Antibody Dependent Complement Deposition - Data Linked, Antibody Dependent Functional Profiling - Data Linked, Antibody Titer - Data Linked, Antibody Titer Analysis - Data Linked, Antibody-Dependent Cellular Phagocytosis - Data Linked, Antibody-Dependent Cellular Phagocytosis - Data Linked, Antibody-Dependent Cellular Phagocytosis Analysis - Data Linked, Antibody-Dependent NK Cell Activation - Data Linked, Antibody-Dependent NK Cell Activation Analysis - Data Linked, Antibody-Dependent Neutrophil Phagocytosis - Data Linked, Antibody-Dependent Neutrophil Phagocytosis - Data Linked, Antibody-Dependent Neutrophil Phagocytosis Analysis - Data Linked, Antibody-dependent Cellular Phagocytosis - Data Linked, Antibody-dependent Complement Deposition - Data Linked, Antibody-dependent NK Cell Activation - Data Linked, Antibody-dependent Neutrophil Phagocytosis - Data Linked, Bacterial Challenge - Metadata, Bacterial Extraction - Metadata, Bacterial Extraction - Metadata, Bacterial Extraction - Metadata, Bacterial Extraction - Metadata, Bacterial Survivability Restriction Assay - Data Linked, Bacterial Survivability Restriction Assay - Data Linked, Bacterial Survivability Restriction Assay: Validation Data - Data Attached, CITESEQ Analysis - Data Linked, Cell Extraction - Metadata, Cell Extraction: Validation Data - Metadata, Cell Isolation - Metadata, Cell Isolation - Metadata, Cell Sorting – Data Linked, DNA Extraction - Metadata, Digitally Barcoded Mtb Matrix Analysis - Data Attached, Digitally Barcoded Mtb Matrix Analysis - Data Attached, Digitally Barcoded Mtb Matrix Analysis - Data Attached, Digitally Barcoded Mtb Matrix Analysis - Data Linked, ELISA - Data Linked, ELISA Assay - Data Linked, FC Receptor Binding - Data Linked, FC Receptor Binding Analysis - Data Linked, FC Receptor Binding Assay - Data Linked, FC-Receptor Binding Assay - Data Linked, FCS Analysis - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry - Data Linked, Flow Cytometry Analysis - Data Attached, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Analysis - Data Linked, Flow Cytometry Processing – Data Attached, Flow Cytometry – Data Linked, Functional Assay – Metadata, Gene Expression Analysis - Data Linked, Gene Expression Analysis: Training Data - Data Linked, Gene Expression Analysis: Validation Data - Data Linked, Glycosylation Assay - Data Linked, Histology - Data Linked, Immunohistochemistry - Data Linked, Immunohistochemistry - Data Linked, Immunohistochemistry – Data Linked, Library Creation - Metadata, Library Creation - Metadata, Library Creation - Metadata, Library Creation – Metadata, Library Prep - Metadata, Library Prep - Metadata, Library Prep - Metadata, Library Prep - Metadata, Library Prep - Metadata, Library Prep: Training Data - Metadata, Library Prep: Validation Data - Metadata, Linear Mixed Model - Data Linked, Luminex - Data Linked, Luminex Assay – Metadata, Luminex Data Processing – Data Attached, Mass Cytometry - Data Linked, Mass Cytometry - Data Linked, Mass Cytometry Analysis - Data Linked, Model Validation, Model Validation - Data Linked, Mouse Challenge – Metadata, NHP Necropsy – Metadata, NHP Tissue Collection – Metadata, PCR: Validation Data - Data Attached, PET-CT Scan - Data Linked, PET-CT Scan - Data Linked, PET-CT Scan - Data Linked, PET-CT Scan Analysis – Data Linked, PET-CT Scan – Data Linked, PET/CT Scan - Data Linked, PET/CT Scan - Data Linked, Pathogen Challenge and Antibody Depletion - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit - Metadata, Patient Visit – Metadata, Patient Visit – Metadata, RNA Extraction: Validation Data - Metadata, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing - Data Linked, Short Read Sequencing: Training Data - Data Linked, Short Read Sequencing: Validation Data - Data Linked, Single Cell Clustering - Data Linked, Single Cell Clustering Analysis - Data Linked, Single Cell Clustering Analysis – Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Analysis - Data Linked, Single Cell Expression Matrix Analysis – Data Linked, Single Cell Sequencing – Data Linked, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection - Metadata, Tissue Collection – Metadata, Tissue Collection: Training Data - Metadata, Tissue Extraction - Metadata, Titer Assay - Data Linked, Titer Assay - Data Linked, Titer Assay Analysis - Data Linked, TransCompR Cross Species Modeling - Data Linked, Western Blot - Data Linked
Snapshots: No snapshots
Caylin G. Winchell, Sarah K. Nyquist, Michael C. Chao, Pauline Maiello, Amy J. Myers, Forrest Hopkins, Michael Chase, Hannah P. Gideon, Kush V. Patel, Joshua D. Bromley, Andrew W. Simonson, Roisin Floyd-O’Sullivan, Marc Wadsworth, Jacob M. Rosenberg, Rockib Uddin, Travis Hughes, Ryan J. Kelly, Josephine Griffo, Jaime Tomko, Edwin Klein, Bonnie Berger, Charles A. Scanga, Joshua Mattila, Sarah M. Fortune, Alex K. Shalek, Philana Ling Lin, JoAnne L. Flynn; CD8+ lymphocytes are critical for early ...
Submitter: Charles Demurjian
Investigation: IMPAcTB
Assays: All Metadata, Bacterial Extraction - Metadata, DNA Extraction - Metadata, Digitally Barcoded Mtb Matrix Analysis - Data Attached, Flow Cytometry - Data Linked, Flow Cytometry Analysis - Data Attached, Immunohistochemistry - Data Linked, PET/CT Scan - Data Linked, Patient Visit - Metadata, Short Read Sequencing - Data Linked, Single Cell Expression Analysis - Data Linked, Tissue Collection - Metadata
Snapshots: Snapshot 1, Snapshot 2
Submitter: Charles Demurjian
Assay type: Experimental Assay Type
Technology type: Technology Type
Investigation: IMPAcTB
Organisms: No organisms
SOPs: P.FLY-220823-V1_P---NHP_housing.docx, P.FLY-231011_Patient Visit CD8
Data files: AB-samples-publish2023-10-11_13-30.xlsx, BAC-samples-publish2023-10-11_13-48.xlsx, NHP-samples-publish2023-10-11_12-59.xlsx, PAV-2-samples-publish2023-10-11_13-11.xlsx
Snapshots: No snapshots
Batch sample publishing
Creator: Charles Demurjian
Submitter: Charles Demurjian
Investigations: IMPAcTB
Studies: CD8+ lymphocytes are critical for early control...
Assays: Patient Visit - Metadata
Download