BioDare_metadata.json
Version 1

Original BioDare metadata, converted to json format

SEEK ID: https://fairdomhub.org/data_files/8641?version=1

Filename: BioDare_metadata.json  Download

Format: JSON document

Size: 47.3 KB

{
  "id": "13228357183121",
  "status": "described",
  "provenance": {
    "desc_version": "1",
    "data_version": "1",
    "uploaded": {
      "by": "Andrew Millar",
      "date": "2011-12-02T14:21:58"
    },
    "modified": [
      {
        "by": "Andrew Millar",
        "date": "2015-09-08T00:12:46",
        "version": "1.1"
      },
      {
        "by": "SYSTEM USER",
        "date": "2014-09-15T16:54:16"
      },
      {
        "by": "SYSTEM USER",
        "date": "2014-09-08T18:30:46"
      },
      {
        "by": "Andrew Millar",
        "date": "2013-09-14T16:32:19"
      },
      {
        "by": "Andrew Millar",
        "date": "2011-12-02T14:34:37"
      },
      {
        "by": "Andrew Millar",
        "date": "2011-12-02T14:22:26"
      },
      {
        "by": "Andrew Millar",
        "date": "2011-12-02T14:21:58"
      },
      {
        "by": "Andrew Millar",
        "date": "2011-12-02T14:21:58"
      }
    ]
  },
  "description_file": {
    "id": "0",
    "file_type": "description file",
    "original_name": "description file",
    "version": [
      {
        "id": "1",
        "file_type": "description file",
        "content_type": "text/xml",
        "original_name": "description file",
        "local_name": "13228357183121_dsc.1.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/13228357183121/13228357183121_dsc.1.xml",
        "uploaded": {
          "by": "Andrew Millar",
          "date": "2011-12-02T14:22:26"
        }
      },
      {
        "id": "0",
        "file_type": "description file",
        "content_type": "text/xml",
        "original_name": "description file",
        "local_name": "13228357183121_dsc.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/13228357183121/13228357183121_dsc.xml",
        "uploaded": {
          "by": "Andrew Millar",
          "date": "2011-12-02T14:21:58"
        }
      }
    ]
  },
  "pedro_file": {
    "id": "0",
    "file_type": "pedro file",
    "original_name": "pedro file",
    "version": {
      "id": "0",
      "file_type": "pedro file",
      "content_type": "text/xml",
      "original_name": "MMS expt4 v1.xml",
      "local_name": "MMS expt4 v1.xml",
      "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/13228357183121/MMS expt4 v1.xml",
      "uploaded": {
        "by": "Andrew Millar",
        "date": "2011-12-02T14:21:58",
        "version": "1"
      }
    }
  },
  "data_file": {
    "id": "0",
    "file_type": "data file",
    "original_name": "Expt4 for BioDare upload.xlsx",
    "version": {
      "id": "0",
      "file_type": "data file",
      "content_type": "application/vnd.openxmlformats-officedocument.spreadsheetml.sheet",
      "original_name": "Expt4 for BioDare upload.xlsx",
      "local_name": "Expt4 for BioDare upload.xlsx",
      "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/13228357183121/Expt4 for BioDare upload.xlsx",
      "uploaded": {
        "by": "Andrew Millar",
        "date": "2011-12-02T14:22:26",
        "version": "1"
      },
      "parameter": [
        {
          "name": "error_type",
          "value": "none"
        },
        {
          "name": "first_data_col",
          "value": "2"
        },
        {
          "name": "first_data_row",
          "value": "4"
        },
        {
          "name": "time_col",
          "value": "1"
        }
      ]
    }
  },
  "std_raw_file": {
    "id": "0",
    "file_type": "data file",
    "original_name": "STANDARD_RAWDATAFILE.txt",
    "version": {
      "id": "0",
      "file_type": "data file",
      "content_type": "text/plain",
      "original_name": "STANDARD_RAWDATAFILE.txt",
      "local_name": "STANDARD_RAWDATAFILE.txt",
      "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/13228357183121/STANDARD_RAWDATAFILE.txt",
      "uploaded": {
        "by": "Andrew Millar",
        "date": "2011-12-02T14:22:26"
      },
      "parameter": [
        {
          "name": "error_type",
          "value": "none"
        },
        {
          "name": "first_data_col",
          "value": "2"
        },
        {
          "name": "first_data_row",
          "value": "4"
        },
        {
          "name": "time_col",
          "value": "1"
        }
      ]
    }
  },
  "numeric_file": {
    "id": "0",
    "file_type": "data file",
    "original_name": "STANDARD_DATAFILE.txt",
    "version": {
      "id": "0",
      "file_type": "data file",
      "content_type": "text/plain",
      "original_name": "STANDARD_DATAFILE.txt",
      "local_name": "STANDARD_DATAFILE.txt",
      "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/13228357183121/STANDARD_DATAFILE.txt",
      "uploaded": {
        "by": "Andrew Millar",
        "date": "2011-12-02T14:22:26"
      },
      "parameter": [
        {
          "name": "error_type",
          "value": "none"
        },
        {
          "name": "first_data_col",
          "value": "2"
        },
        {
          "name": "first_data_row",
          "value": "4"
        },
        {
          "name": "time_col",
          "value": "1"
        }
      ]
    }
  },
  "user_file": {
    "id": "0",
    "file_type": "user file",
    "original_name": "MMS qRT-PCR primers and toc1-2 control.pdf",
    "version": {
      "id": "0",
      "file_type": "data file",
      "content_type": "application/pdf",
      "original_name": "MMS qRT-PCR primers and toc1-2 control.pdf",
      "local_name": "MMS qRT-PCR primers and toc1-2 control.pdf",
      "local_path": "/localdisk/data/biodare/biodare3_prod/Robust/Storage/13228357183121/MMS qRT-PCR primers and toc1-2 control.pdf",
      "uploaded": {
        "by": "Andrew Millar",
        "date": "2015-09-08T00:12:46",
        "version": "1"
      }
    }
  },
  "security": {
    "owner": "andrew",
    "supervisor": "andrew",
    "allowedToRead": [
      "edinburgh",
      "millar",
      "robust",
      "timet"
    ],
    "allowedToWrite": "millar"
  },
  "desc": {
    "experiment_type": "Literature data",
    "id": "13228357183121",
    "status": "described",
    "name": "Clock gene RNAs under RD-RR in clock mutants, expt 4",
    "purpose": "Testing effects of clock gene mutants  (gi-11, TOC1-ox, GI-ox) in the Ws accession, on clock gene RNA profiles, in order to identify hypothetical Y in Locke 2005 model.",
    "description": "Literature data from: 'Extension of a genetic network model by iterative experimentation and mathematical analysis.'\n\t    by: Locke.\n\t    \n\t    First, heroic large-scale RNA profile screen by real-time qPCR in 96-well format, by Megan Southern in 2005. Experiment 4 of 4.",
    "comments": "curated by Andrew Millar, 2011. Data are noisy (especially TOC1, FT, CO, parts of ELF3) in part due to much manual pipetting. Note ACT2 normalisation differs in 3 and 4 from experiments 1 and 2, as only Ws accessions tested.",
    "pubmed_id": "16729048",
    "provenance": {
      "site": "Millar",
      "author": "Locke",
      "start_date": "2005-06-28"
    },
    "growth_condition": {
      "name": "12hR:12hD",
      "medium": "Agar 1.5% MS 1 3% Sucrose",
      "stratification": "3 days at 4C",
      "growth_space": "temperature-controlled incubator, University of Warwick",
      "duration": "5.0",
      "comment": "need to find red light source, intensity was 13–20 umol.m-2.s-1",
      "temperature_conditions": {
        "label": "const. 22.0C",
        "env_conditions": {
          "type": "constant_temp",
          "label": "const. 22.0C",
          "duration": "5",
          "env_day": {
            "type": "constant_temp",
            "label": "constant temperature",
            "duration": "5",
            "cycle_length": "24",
            "base_value": "22.0",
            "second_value": "22.0"
          }
        }
      },
      "light_conditions": {
        "label": "R: LD 12:00:12:00",
        "light_channel": {
          "spectrum": "red",
          "intensity": "16",
          "source": "LED",
          "env_conditions": {
            "type": "diurnal_light",
            "label": "LD 12:00:12:00",
            "duration": "5",
            "env_day": {
              "type": "diurnal_light",
              "label": "diurnal light",
              "duration": "5",
              "cycle_length": "24",
              "base_value": "0.0",
              "second_value": "100.0",
              "env_period": {
                "start_time": "0:00",
                "duration": "12:00"
              }
            }
          }
        }
      }
    },
    "experimental_condition": {
      "name": "12hR:12hD; RR",
      "medium": "Agar 1.5% MS 1 3% Sucrose",
      "growth_space": "temperature-controlled incubator, University of Warwick",
      "duration": "3.0",
      "comment": "need to find red light source, intensity was 13–20 umol.m-2.s-1",
      "temperature_conditions": {
        "label": "const. 22.0C",
        "env_conditions": {
          "type": "constant_temp",
          "label": "const. 22.0C",
          "duration": "3",
          "env_day": {
            "type": "constant_temp",
            "label": "constant temperature",
            "duration": "3",
            "cycle_length": "24",
            "base_value": "22.0",
            "second_value": "22.0"
          }
        }
      },
      "light_conditions": {
        "label": "R: 1*LD 12:00:12:00; 2*LL",
        "light_channel": {
          "spectrum": "red",
          "intensity": "16",
          "source": "LED",
          "env_conditions": {
            "type": "light_complex",
            "label": "1*LD 12:00:12:00; 2*LL",
            "duration": "3",
            "env_day": [
              {
                "type": "diurnal_light",
                "label": "diurnal light",
                "duration": "1",
                "cycle_length": "24",
                "base_value": "0.0",
                "second_value": "100.0",
                "env_period": {
                  "start_time": "0:00",
                  "duration": "12:00"
                }
              },
              {
                "type": "constant_light",
                "label": "constant light",
                "duration": "2",
                "cycle_length": "24",
                "base_value": "0.0",
                "second_value": "100.0",
                "env_period": {
                  "start_time": "0:00",
                  "duration": "24:00"
                }
              }
            ]
          }
        }
      }
    },
    "measurement": {
      "technique": "RT-PCR",
      "equipment": "ABI PRISM 7700 (Applied Biosystems, Warrington, UK), located at HRI Wellesbourne.",
      "parameters": "ABI SYBRgreen PCR Mixin a final volume of 15 ml. clock RNA abundance was normalised relative to ACTIN2 (ACT2), using a cDNA dilution series for each primer set in each experiment. \nEach RNA sample was assayed in triplicate. This upload is one of  two independent biological replicates, the other is uploaded separately.\n\nNormalisation between WS and C24 was necessary, as ACT2 detection levels on average were 4x greater in Ws than in C24. Therefore all GoI/ACT2 ratios were multiplied by the average level of ACT2 for that genotype in that experiment.",
      "description": "Literature data from: ''\n\t    by: .\n\t    \n\t    The following primers were used for the paper, each at 300 nM. Other primer sequences in Megan Southern PhD thesis.\nGI forward primer AATTCAGCACGCGCCTATTG,\nGI reverse primer GTTGCTTCTGCTGCAGGAACTT;\nACT2 forward primer CAGTGTCTGGATCGGAGGAT,\nACT2 reverse primer TGAACAATCGATGGACCTGA",
      "param": [
        {
          "@name": "RD error_type",
          "@value": "none"
        },
        {
          "@name": "RD first_data_col",
          "@value": "2"
        },
        {
          "@name": "RD first_data_row",
          "@value": "4"
        },
        {
          "@name": "RD time_col",
          "@value": "1"
        }
      ]
    },
    "sample_preparation": {
      "method": "Samples of 150 ml packed volume of seedlings were harvested into RNAlater buffer (Ambion, Huntingdon, UK) to stabilise RNAs. Seedling harvesting was actually offset by about 10 minutes from first to last sample at each timepoint. First sample always harvested at the marked time, other samples later. Genotype order of harvest was always elf3, elf4, tic, toc1, 2CAC (=C24 WT), lhy;cca1, Ws WT.\n\nSeedlings were homogenised in RLT buffer (Qiagen, Crawley, UK) using a MixerMill MM300 at a frequency of 30 s1 for 3 min with a 5mm stainless steel cone ball (Retsch, Leeds, UK). Total RNA was isolated using a Plant RNeasy kit and RNase-free DNase (Qiagen, Crawley, UK) according to the manufacturer’s instructions. A 1 mg portion of total RNA was reverse-transcribed using the RevertAid cDNA kit (Fermentas, Helena Biosciences, Sunderland, UK) with random hexamer primers, according to the manufacturer’s instructions."
    },
    "samples": {
      "sample": [
        {
          "sample_id": "1",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown"
          },
          "marker": "CCA1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "2",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown"
          },
          "marker": "CCA1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "3",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX",
            "line": "unknown"
          },
          "marker": "CCA1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "4",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX",
            "line": "unknown"
          },
          "marker": "CCA1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "5",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown"
          },
          "marker": "GI",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "6",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown"
          },
          "marker": "GI",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "7",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX",
            "line": "unknown"
          },
          "marker": "GI",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "8",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX",
            "line": "unknown"
          },
          "marker": "GI",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "9",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown"
          },
          "marker": "TOC1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "10",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown"
          },
          "marker": "TOC1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "11",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX",
            "line": "unknown"
          },
          "marker": "TOC1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "12",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX",
            "line": "unknown"
          },
          "marker": "TOC1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "13",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown"
          },
          "marker": "ELF4",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "14",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown"
          },
          "marker": "ELF4",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "15",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX",
            "line": "unknown"
          },
          "marker": "ELF4",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "16",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX",
            "line": "unknown"
          },
          "marker": "ELF4",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "17",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown"
          },
          "marker": "LHY",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "18",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown"
          },
          "marker": "LHY",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "19",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX",
            "line": "unknown"
          },
          "marker": "LHY",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "20",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX",
            "line": "unknown"
          },
          "marker": "LHY",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "21",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown"
          },
          "marker": "ELF3",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "22",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown"
          },
          "marker": "ELF3",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "23",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX",
            "line": "unknown"
          },
          "marker": "ELF3",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "24",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX",
            "line": "unknown"
          },
          "marker": "ELF3",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "25",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown"
          },
          "marker": "CO",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "26",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown"
          },
          "marker": "CO",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "27",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX",
            "line": "unknown"
          },
          "marker": "CO",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "28",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown"
          },
          "marker": "FT",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "29",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown"
          },
          "marker": "FT",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        },
        {
          "sample_id": "30",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "age": "0",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX",
            "line": "unknown"
          },
          "marker": "FT",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR",
          "ignored": "false"
        }
      ]
    }
  },
  "pedro": {
    "@xmlns:xsi": "http://www.w3.org/2001/XMLSchema-instance",
    "@xsi:schemaLocation": "/O:/communal/DataDescription/models/literature/model/full_literature.xsd",
    "name": "Clock gene RNAs under RD-RR in clock mutants, expt 4",
    "purpose": "Testing effects of clock gene mutants  (gi-11, TOC1-ox, GI-ox) in the Ws accession, on clock gene RNA profiles, in order to identify hypothetical Y in Locke 2005 model.",
    "description": "First, heroic large-scale RNA profile screen by real-time qPCR in 96-well format, by Megan Southern in 2005. Experiment 4 of 4.",
    "comments": "curated by Andrew Millar, 2011. Data are noisy (especially TOC1, FT, CO, parts of ELF3) in part due to much manual pipetting. Note ACT2 normalisation differs in 3 and 4 from experiments 1 and 2, as only Ws accessions tested.",
    "pubmed_id": "16729048",
    "provenance": {
      "pub_title": "Extension of a genetic network model by iterative experimentation and mathematical analysis.",
      "first_author": "Locke",
      "group": "Millar",
      "pub_date": "2005-06-28"
    },
    "growth_condition": {
      "name": "12hR:12hD",
      "medium": "Agar 1.5% MS 1 3% Sucrose",
      "stratification": "3 days at 4C",
      "growth_space": "temperature-controlled incubator, University of Warwick",
      "duration": "5",
      "comment": "need to find red light source, intensity was 13–20 umol.m-2.s-1",
      "temperature_conditions": {
        "constant_temp": {
          "cycle_length": "24",
          "base_temp": "22"
        }
      },
      "light_conditions": {
        "light_channel": {
          "spectrum": "red",
          "intensity": "16",
          "source": "LED",
          "diurnal_light": {
            "cycle_length": "24",
            "start_time": "0",
            "duration": "12"
          }
        }
      }
    },
    "experimental_condition": {
      "name": "12hR:12hD; RR",
      "medium": "Agar 1.5% MS 1 3% Sucrose",
      "growth_space": "temperature-controlled incubator, University of Warwick",
      "duration": "3",
      "comment": "need to find red light source, intensity was 13–20 umol.m-2.s-1",
      "temperature_conditions": {
        "constant_temp": {
          "cycle_length": "24",
          "base_temp": "22"
        }
      },
      "light_conditions": {
        "light_channel": {
          "spectrum": "red",
          "intensity": "16",
          "source": "LED",
          "light_complex_settings": {
            "light_days": [
              {
                "start_day": "1",
                "duration": "1",
                "diurnal_light": {
                  "cycle_length": "24",
                  "start_time": "0",
                  "duration": "12"
                }
              },
              {
                "start_day": "2",
                "duration": "2",
                "constant_light": {
                  "cycle_length": "24"
                }
              }
            ]
          }
        }
      }
    },
    "measurement": {
      "technique": "RT-PCR",
      "equipment": "ABI PRISM 7700 (Applied Biosystems, Warrington, UK), located at HRI Wellesbourne.",
      "parameters": "ABI SYBRgreen PCR Mixin a final volume of 15 ml. clock RNA abundance was normalised relative to ACTIN2 (ACT2), using a cDNA dilution series for each primer set in each experiment. \nEach RNA sample was assayed in triplicate. This upload is one of  two independent biological replicates, the other is uploaded separately.\n\nNormalisation between WS and C24 was necessary, as ACT2 detection levels on average were 4x greater in Ws than in C24. Therefore all GoI/ACT2 ratios were multiplied by the average level of ACT2 for that genotype in that experiment.",
      "description": "The following primers were used for the paper, each at 300 nM. Other primer sequences in Megan Southern PhD thesis.\nGI forward primer AATTCAGCACGCGCCTATTG,\nGI reverse primer GTTGCTTCTGCTGCAGGAACTT;\nACT2 forward primer CAGTGTCTGGATCGGAGGAT,\nACT2 reverse primer TGAACAATCGATGGACCTGA"
    },
    "sample_preparation": {
      "method": "Samples of 150 ml packed volume of seedlings were harvested into RNAlater buffer (Ambion, Huntingdon, UK) to stabilise RNAs. Seedling harvesting was actually offset by about 10 minutes from first to last sample at each timepoint. First sample always harvested at the marked time, other samples later. Genotype order of harvest was always elf3, elf4, tic, toc1, 2CAC (=C24 WT), lhy;cca1, Ws WT.\n\nSeedlings were homogenised in RLT buffer (Qiagen, Crawley, UK) using a MixerMill MM300 at a frequency of 30 s1 for 3 min with a 5mm stainless steel cone ball (Retsch, Leeds, UK). Total RNA was isolated using a Plant RNeasy kit and RNase-free DNase (Qiagen, Crawley, UK) according to the manufacturer’s instructions. A 1 mg portion of total RNA was reverse-transcribed using the RevertAid cDNA kit (Fermentas, Helena Biosciences, Sunderland, UK) with random hexamer primers, according to the manufacturer’s instructions."
    },
    "samples": {
      "sample": [
        {
          "sample_id": "1",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type"
          },
          "marker": "CCA1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "2",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11"
          },
          "marker": "CCA1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "3",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX"
          },
          "marker": "CCA1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "4",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX"
          },
          "marker": "CCA1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "5",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type"
          },
          "marker": "GI",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "6",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11"
          },
          "marker": "GI",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "7",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX"
          },
          "marker": "GI",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "8",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX"
          },
          "marker": "GI",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "9",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type"
          },
          "marker": "TOC1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "10",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11"
          },
          "marker": "TOC1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "11",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX"
          },
          "marker": "TOC1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "12",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX"
          },
          "marker": "TOC1",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "13",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type"
          },
          "marker": "ELF4",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "14",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11"
          },
          "marker": "ELF4",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "15",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX"
          },
          "marker": "ELF4",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "16",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX"
          },
          "marker": "ELF4",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "17",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type"
          },
          "marker": "LHY",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "18",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11"
          },
          "marker": "LHY",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "19",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX"
          },
          "marker": "LHY",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "20",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX"
          },
          "marker": "LHY",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "21",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type"
          },
          "marker": "ELF3",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "22",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11"
          },
          "marker": "ELF3",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "23",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX"
          },
          "marker": "ELF3",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "24",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-OX"
          },
          "marker": "ELF3",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "25",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type"
          },
          "marker": "CO",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "26",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11"
          },
          "marker": "CO",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "27",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX"
          },
          "marker": "CO",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "28",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type"
          },
          "marker": "FT",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "29",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11"
          },
          "marker": "FT",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        },
        {
          "sample_id": "30",
          "sample_type": "group of seedlings",
          "origin": "group of seedlings",
          "growth_stage": "seedling",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -OX"
          },
          "marker": "FT",
          "growth_cond_name": "12hR:12hD",
          "experiment_cond_name": "12hR:12hD; RR"
        }
      ]
    }
  },
  "biblio": {}
}
help Creators and Submitter
Creators
Not specified
Additional credit

Locke

Submitter
Activity

Views: 539   Downloads: 105

Created: 18th Jun 2026 at 12:38

Last updated: 1st Sep 2026 at 10:41

help Tags

This item has not yet been tagged.

help Attributions

None

Version History

Version 1 (earliest) Created 18th Jun 2026 at 12:38 by Daniel Thedie

No revision comments

Powered by
(v.1.18.2)