Original BioDare metadata, converted to json format
{
"id": "12820610913763",
"status": "finished",
"provenance": {
"desc_version": "11",
"data_version": "2",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-08-17T17:04:51"
},
"modified": [
{
"by": "Karen Haliday",
"date": "2015-10-19T16:43:55",
"version": "11.2"
},
{
"by": "Karen Haliday",
"date": "2015-10-18T02:21:40",
"version": "10.2"
},
{
"by": "Karen Haliday",
"date": "2015-10-18T02:21:33",
"version": "10.2"
},
{
"by": "SYSTEM USER",
"date": "2014-09-15T16:54:01"
},
{
"by": "SYSTEM USER",
"date": "2014-09-08T18:30:38"
},
{
"by": "Jayne Griffiths",
"date": "2011-12-02T10:49:53"
},
{
"by": "Jayne Griffiths",
"date": "2011-12-02T10:49:43"
},
{
"by": "Jayne Griffiths",
"date": "2011-12-01T16:51:21"
},
{
"by": "Jayne Griffiths",
"date": "2011-12-01T16:50:15"
},
{
"by": "Karen Haliday",
"date": "2011-12-01T15:27:54"
},
{
"by": "Tomasz Zielinski",
"date": "2011-05-10T19:16:47"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2011-01-13T16:00:39"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-03T18:40:57"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-03T14:26:40"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-02T16:13:47"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-12T13:31:16"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T15:15:39"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T14:00:33"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:57:03"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:51:50"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:51:32"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:50:46"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:44:58"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:43:42"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-08-17T17:09:48"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-08-17T17:04:51"
}
]
},
"description_file": {
"id": "0",
"file_type": "description file",
"original_name": "description file",
"version": [
{
"id": "11",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.11.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/12820610913763_dsc.11.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:49:53"
}
},
{
"id": "10",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.10.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/12820610913763_dsc.10.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:49:43"
}
},
{
"id": "9",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.9.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/12820610913763_dsc.9.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T16:51:21"
}
},
{
"id": "8",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.8.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/12820610913763_dsc.8.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T16:50:15"
}
},
{
"id": "7",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.7.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/12820610913763_dsc.7.xml",
"uploaded": {
"by": "Tomasz Zielinski",
"date": "2011-05-10T19:16:47"
}
},
{
"id": "6",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.6.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/12820610913763_dsc.6.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2011-01-13T16:00:39"
}
},
{
"id": "5",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.5.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/12820610913763_dsc.5.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T14:00:33"
}
},
{
"id": "4",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.4.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/12820610913763_dsc.4.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:57:03"
}
},
{
"id": "3",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.3.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/12820610913763_dsc.3.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:50:46"
}
},
{
"id": "2",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.2.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/12820610913763_dsc.2.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:44:58"
}
},
{
"id": "1",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.1.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/12820610913763_dsc.1.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:43:42"
}
},
{
"id": "0",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820610913763_dsc.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/12820610913763_dsc.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-08-17T17:04:51"
}
}
]
},
"pedro_file": {
"id": "0",
"file_type": "pedro file",
"original_name": "pedro file",
"version": [
{
"id": "8",
"file_type": "pedro file",
"content_type": "text/xml",
"original_name": "Q-PCR LD 12-12 LUX.xml",
"local_name": "Q-PCR LD 12-12 LUX.1.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/Q-PCR LD 12-12 LUX.1.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:49:43",
"version": "9"
}
},
{
"id": "7",
"file_type": "pedro file",
"content_type": "text/xml",
"original_name": "Q-PCR LD 12-12 LUX.xml",
"local_name": "Q-PCR LD 12-12 LUX.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/Q-PCR LD 12-12 LUX.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T16:50:15",
"version": "8"
}
},
{
"id": "6",
"file_type": "pedro file",
"content_type": "application/octet-stream",
"original_name": "LUX-LD-17C-OFFSUC.xml",
"local_name": "LUX-LD-17C-OFFSUC.1.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/LUX-LD-17C-OFFSUC.1.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2011-01-13T16:00:39",
"version": "7"
}
},
{
"id": "5",
"file_type": "pedro file",
"content_type": "application/octet-stream",
"original_name": "LUX-LD-17C-OFFSUC.xml",
"local_name": "LUX-LD-17C-OFFSUC.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/LUX-LD-17C-OFFSUC.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T14:00:33",
"version": "6"
}
},
{
"id": "4",
"file_type": "pedro file",
"content_type": "application/octet-stream",
"original_name": "lux-17C-LD-OffSuc.xml",
"local_name": "lux-17C-LD-OffSuc.1.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/lux-17C-LD-OffSuc.1.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:57:03",
"version": "5"
}
},
{
"id": "3",
"file_type": "pedro file",
"content_type": "text/xml",
"original_name": "lux-17C-LD-OffSuc.xml",
"local_name": "lux-17C-LD-OffSuc.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/lux-17C-LD-OffSuc.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:50:46",
"version": "4"
}
},
{
"id": "2",
"file_type": "pedro file",
"content_type": "text/xml",
"original_name": "lhy-17C-LD-OffSuc.xml",
"local_name": "lhy-17C-LD-OffSuc.2.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/lhy-17C-LD-OffSuc.2.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:44:58",
"version": "3"
}
},
{
"id": "1",
"file_type": "pedro file",
"content_type": "text/xml",
"original_name": "lhy-17C-LD-OffSuc.xml",
"local_name": "lhy-17C-LD-OffSuc.1.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/lhy-17C-LD-OffSuc.1.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:43:42",
"version": "2"
}
},
{
"id": "0",
"file_type": "pedro file",
"content_type": "text/xml",
"original_name": "lhy-17C-LD-OffSuc.xml",
"local_name": "lhy-17C-LD-OffSuc.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/lhy-17C-LD-OffSuc.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-08-17T17:04:51",
"version": "1"
}
}
]
},
"bibliographyFile": {
"id": "0",
"file_type": "BIBLIOGRAPHY",
"original_name": "12820610913763_bibl.xml",
"version": [
{
"id": "11",
"file_type": "BIBLIOGRAPHY",
"content_type": "text/plain",
"original_name": "12820610913763_bibl.xml",
"local_name": "12820610913763_bibl.1.xml",
"local_path": "/localdisk/data/biodare/biodare3_prod/Robust/Storage/12820610913763/12820610913763_bibl.1.xml",
"uploaded": {
"by": "Karen Haliday",
"date": "2015-10-19T16:43:55",
"version": "11"
}
},
{
"id": "10",
"file_type": "BIBLIOGRAPHY",
"content_type": "text/plain",
"original_name": "12820610913763_bibl.xml",
"local_name": "12820610913763_bibl.xml",
"local_path": "/localdisk/data/biodare/biodare3_prod/Robust/Storage/12820610913763/12820610913763_bibl.xml",
"uploaded": {
"by": "Karen Haliday",
"date": "2015-10-18T02:21:33",
"version": "10"
}
}
]
},
"data_file": {
"id": "0",
"file_type": "data file",
"original_name": "2011-12 LUX LD.xls",
"version": [
{
"id": "1",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "2011-12 LUX LD.xls",
"local_name": "2011-12 LUX LD.1.xls",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/2011-12 LUX LD.1.xls",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:49:53",
"version": "2"
},
"parameter": [
{
"name": "reference_col",
"value": "2"
},
{
"name": "first_data_row",
"value": "2"
},
{
"name": "main_data_col",
"value": "8"
}
]
},
{
"id": "0",
"file_type": "data file",
"content_type": "application/octet-stream",
"original_name": "2011-12 LUX LD.xls",
"local_name": "2011-12 LUX LD.xls",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/2011-12 LUX LD.xls",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T16:51:21",
"version": "1"
},
"parameter": [
{
"name": "reference_col",
"value": "2"
},
{
"name": "first_data_row",
"value": "2"
},
{
"name": "main_data_col",
"value": "8"
}
]
}
]
},
"std_raw_file": {
"id": "0",
"file_type": "data file",
"original_name": "STANDARD_RAWDATAFILE.txt",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "text/plain",
"original_name": "STANDARD_RAWDATAFILE.txt",
"local_name": "STANDARD_RAWDATAFILE.1.txt",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/STANDARD_RAWDATAFILE.1.txt",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:49:53"
},
"parameter": [
{
"name": "reference_col",
"value": "2"
},
{
"name": "first_data_row",
"value": "2"
},
{
"name": "main_data_col",
"value": "8"
}
]
}
},
"numeric_file": {
"id": "0",
"file_type": "data file",
"original_name": "STANDARD_DATAFILE.txt",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "text/plain",
"original_name": "STANDARD_DATAFILE.txt",
"local_name": "STANDARD_DATAFILE.1.txt",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820610913763/STANDARD_DATAFILE.1.txt",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:49:53"
},
"parameter": [
{
"name": "reference_col",
"value": "2"
},
{
"name": "first_data_row",
"value": "2"
},
{
"name": "main_data_col",
"value": "8"
}
]
}
},
"user_file": [
{
"id": "0",
"file_type": "user file",
"original_name": "Plt15&16-lux-200710-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plt15&16-lux-200710-Prog.xls",
"local_name": "Plt15&16-lux-200710-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/Plt15&16-lux-200710-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:51:32"
}
}
},
{
"id": "1",
"file_type": "user file",
"original_name": "Plt17-lux-260710-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plt17-lux-260710-Prog.xls",
"local_name": "Plt17-lux-260710-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/Plt17-lux-260710-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:51:32"
}
}
},
{
"id": "2",
"file_type": "user file",
"original_name": "Plt18-lux-280710-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plt18-lux-280710-Prog.xls",
"local_name": "Plt18-lux-280710-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/Plt18-lux-280710-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:51:32"
}
}
},
{
"id": "3",
"file_type": "user file",
"original_name": "Plt19&20-lux-120810-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plt19&20-lux-120810-Prog.xls",
"local_name": "Plt19&20-lux-120810-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/Plt19&20-lux-120810-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:51:50"
}
}
},
{
"id": "4",
"file_type": "user file",
"original_name": "Plt21-lux-190810-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plt21-lux-190810-Prog.xls",
"local_name": "Plt21-lux-190810-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/Plt21-lux-190810-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:51:50"
}
}
},
{
"id": "5",
"file_type": "user file",
"original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
"version": [
{
"id": "1",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
"local_name": "17C-LD-OS-wt-prr-gi-lc-toc.1.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/17C-LD-OS-wt-prr-gi-lc-toc.1.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-12T13:31:16"
}
},
{
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
"local_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/17C-LD-OS-wt-prr-gi-lc-toc.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:51:50"
}
}
]
},
{
"id": "6",
"file_type": "user file",
"original_name": "17C-LD-OS-wt-cca1.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-wt-cca1.xls",
"local_name": "17C-LD-OS-wt-cca1.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/17C-LD-OS-wt-cca1.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-02T16:13:47"
}
}
},
{
"id": "7",
"file_type": "user file",
"original_name": "17C-LD-OS-wt-lhy21.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-wt-lhy21.xls",
"local_name": "17C-LD-OS-wt-lhy21.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/17C-LD-OS-wt-lhy21.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-02T16:13:47"
}
}
},
{
"id": "8",
"file_type": "user file",
"original_name": "17C-LD-OS-lhyccagi.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-lhyccagi.xls",
"local_name": "17C-LD-OS-lhyccagi.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/17C-LD-OS-lhyccagi.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-03T14:26:40"
}
}
},
{
"id": "9",
"file_type": "user file",
"original_name": "17C-LD-OS-prr7-3.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-prr7-3.xls",
"local_name": "17C-LD-OS-prr7-3.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820610913763/17C-LD-OS-prr7-3.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-03T18:40:57"
}
}
}
],
"security": {
"owner": "jgriffiths",
"supervisor": "karen",
"allowedToRead": [
"edinburgh",
"robust",
"public"
]
},
"open_access_info": {
"grantedBy": "karen",
"grantedOn": "2015-10-18T02:21:40",
"licence": "CC_BY"
},
"desc": {
"experiment_type": "qPCR on Robot",
"id": "12820610913763",
"status": "finished",
"name": "Q-PCR LD (12:12) 17C LUX",
"purpose": "Experiment carry out to reparameterize the clock off Succrose",
"description": "Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.",
"comments": "Sample time 24h. 24h sample lost for some genotypes",
"provenance": {
"site": "Edinburgh",
"author": "Aurora Pinas-Fernandez",
"start_date": "2010-06-01"
},
"growth_condition": {
"name": "Entrainment 22C Diurnal",
"medium": "Agar 1.2% MS 0.5",
"incubation": "3 hours at 4C",
"growth_space": "Sanyo",
"duration": "7.0",
"temperature_conditions": {
"label": "const. 22.0C",
"env_conditions": {
"type": "constant_temp",
"label": "const. 22.0C",
"duration": "7",
"env_day": {
"type": "constant_temp",
"label": "constant temperature",
"duration": "7",
"cycle_length": "24",
"base_value": "22.0",
"second_value": "22.0"
}
}
},
"light_conditions": {
"label": "W: LD 12:00:12:00",
"light_channel": {
"spectrum": "white",
"intensity": "60",
"source": "tube",
"env_conditions": {
"type": "diurnal_light",
"label": "LD 12:00:12:00",
"duration": "7",
"env_day": {
"type": "diurnal_light",
"label": "diurnal light",
"duration": "7",
"cycle_length": "24",
"base_value": "0.0",
"second_value": "100.0",
"env_period": {
"start_time": "0:00",
"duration": "12:00"
}
}
}
}
}
},
"experimental_condition": {
"name": "17C LD (12:12) Off Sucrose",
"medium": "Agar 1.2% MS 0.5",
"growth_space": "Binder",
"duration": "6.0",
"exp_time_zero": "72",
"temperature_conditions": {
"label": "const. 17.0C",
"env_conditions": {
"type": "constant_temp",
"label": "const. 17.0C",
"duration": "6",
"env_day": {
"type": "constant_temp",
"label": "constant temperature",
"duration": "6",
"cycle_length": "24",
"base_value": "17.0",
"second_value": "17.0"
}
}
},
"light_conditions": {
"label": "W: LD 12:00:12:00",
"light_channel": {
"spectrum": "white",
"intensity": "60",
"source": "tube",
"env_conditions": {
"type": "diurnal_light",
"label": "LD 12:00:12:00",
"duration": "6",
"env_day": {
"type": "diurnal_light",
"label": "diurnal light",
"duration": "6",
"cycle_length": "24",
"base_value": "0.0",
"second_value": "100.0",
"env_period": {
"start_time": "0:00",
"duration": "12:00"
}
}
}
}
}
},
"measurement": {
"technique": "RT-PCR",
"equipment": "Robot + Light Cycler 480",
"parameters": "Primers JF311 & JF312 Cycle: 2 - Roche Parameters-cDNA dil 1/10",
"description": "JF311-LUX-F;TGCTCATCATCTTCACAAACC\nJF312-LUX-R ;CTTCCTCTCCCATTTCAAACTC",
"param": [
{
"@name": "RD reference_col",
"@value": "2"
},
{
"@name": "RD first_data_row",
"@value": "2"
},
{
"@name": "RD main_data_col",
"@value": "8"
}
]
},
"sample_preparation": {
"method": "Samples were harvested and keeped on RNAlader for some weeks, at 4C and -20C. RNa extraction was done following protocol of GE Health Care-illustra RNAspin 96RNA Isolation kit. Samples were spect with Nanodrop. cDNA synthesis was done with Super Script Vilo kit( Invitrogene) from 1ugr RNA."
},
"samples": {
"sample": [
{
"sample_id": "1166",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1167",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1168",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1169",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1170",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1171",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1172",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1173",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1174",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1175",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1176",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1177",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1178",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1179",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1180",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1181",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1182",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1183",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1184",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1185",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1186",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1187",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1188",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1189",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1190",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1191",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1192",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1193",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1194",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1195",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1196",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1197",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1198",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1199",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1200",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1201",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1202",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1203",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1204",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1205",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1206",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1207",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1208",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1209",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1210",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1211",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1212",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1213",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1214",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1215",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1216",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1217",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1218",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1219",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1220",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1221",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1222",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1223",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1224",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1225",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1226",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1227",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1228",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1229",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1230",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1231",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1232",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1233",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1234",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1235",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1236",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1237",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1238",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1239",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1240",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1241",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1242",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1243",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1244",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1245",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1246",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1288",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1289",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1290",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1291",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1292",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1293",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1294",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1295",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1296",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1297",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1298",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1299",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1300",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1301",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1302",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1303",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1304",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1305",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1306",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1307",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1308",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1309",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1310",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1311",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1312",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1313",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1314",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1315",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1316",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1317",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1318",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1319",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1320",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1321",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1322",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1323",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1324",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1325",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1326",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1327",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1328",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1329",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1330",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1331",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1332",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1333",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1334",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1335",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1336",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1337",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1338",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1339",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1340",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1341",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1342",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1343",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1344",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1345",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1346",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1347",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1348",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1349",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1350",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1351",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1352",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1353",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1354",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1355",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1356",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1357",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1358",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1359",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1360",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1361",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1362",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1363",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1364",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1365",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1366",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1367",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1368",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1369",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1370",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1371",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1372",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1373",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1374",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1375",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1376",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1377",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1378",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1379",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1380",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1381",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1382",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1383",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1384",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1385",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1386",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1387",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1388",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1389",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1390",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1391",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1392",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1393",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1394",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1395",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1396",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1397",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1398",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1399",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1400",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1401",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1402",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1403",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1404",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1405",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1406",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1407",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1408",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1409",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1410",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1411",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1412",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1413",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1414",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1415",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1416",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1417",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1418",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1419",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1420",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1421",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1422",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1423",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1424",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1425",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1426",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1427",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1428",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1429",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1430",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1431",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1432",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1433",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1434",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1435",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1436",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1437",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1438",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1439",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1440",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1441",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1442",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1443",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1444",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1445",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1446",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1805",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1806",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1807",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1808",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1809",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1810",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1811",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1812",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1813",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1814",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1815",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1816",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1817",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1818",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1819",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1820",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1821",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1822",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1823",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1824",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1825",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1826",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1827",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1828",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1829",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1830",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1831",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1832",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1833",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1834",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1835",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1836",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1837",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1838",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1839",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1840",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1841",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1842",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1843",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1844",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1845",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1846",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1847",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1848",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1849",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1850",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1851",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1852",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1853",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1854",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1855",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1856",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1857",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1858",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1859",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1860",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1861",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1862",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1863",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1864",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1865",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1866",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1867",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1868",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1869",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1870",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1871",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1872",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1873",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1874",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1875",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1876",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1877",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1878",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1879",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1880",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1881",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1882",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1883",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1884",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1885",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1886",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1887",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1888",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1889",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1890",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1891",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1892",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1893",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1894",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1895",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1896",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1897",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1898",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1899",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1900",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1901",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1902",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1903",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1904",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1905",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1906",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1907",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1908",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1909",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1910",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1911",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1912",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1913",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1914",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1915",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1916",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1917",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1918",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1919",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1920",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1921",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1922",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1923",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1924",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1925",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1926",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1927",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1928",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1929",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1930",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1931",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1932",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1933",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1934",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1935",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1936",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1937",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1938",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1939",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1940",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1941",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1942",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1943",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1944",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1945",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1946",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1947",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1948",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1949",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1950",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1951",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1952",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1953",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1954",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1955",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1956",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1957",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1958",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1959",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1960",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
}
]
}
},
"pedro": {
"@xmlns:xsi": "http://www.w3.org/2001/XMLSchema-instance",
"@xsi:schemaLocation": "/W:/ROBuST/DataDescription/models/pcr/model/pcr_model.xsd",
"status": "finished",
"name": "Q-PCR LD (12:12) 17C LUX",
"purpose": "Experiment carry out to reparameterize the clock off Succrose",
"description": "Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.",
"comments": "Sample time 24h. 24h sample lost for some genotypes",
"provenance": {
"site": "Edinburgh",
"author": "Aurora Pinas-Fernandez",
"start_date": "2010-06-01"
},
"growth_condition": {
"name": "Entrainment 22C Diurnal",
"medium": "Agar 1.2% MS 0.5",
"incubation": "3 hours at 4C",
"growth_space": "Sanyo",
"duration": "7",
"temperature_conditions": {
"constant_temp": {
"cycle_length": "24",
"base_temp": "22"
}
},
"light_conditions": {
"light_channel": {
"spectrum": "white",
"intensity": "60",
"source": "tube",
"diurnal_light": {
"cycle_length": "24",
"start_time": "0",
"duration": "12"
}
}
}
},
"experimental_condition": {
"name": "17C LD (12:12) Off Sucrose",
"medium": "Agar 1.2% MS 0.5",
"growth_space": "Binder",
"duration": "6",
"exp_time_zero": "72",
"temperature_conditions": {
"constant_temp": {
"cycle_length": "24",
"base_temp": "17"
}
},
"light_conditions": {
"light_channel": {
"spectrum": "white",
"intensity": "60",
"source": "tube",
"diurnal_light": {
"cycle_length": "24",
"start_time": "0",
"duration": "12"
}
}
}
},
"measurement": {
"technique": "RT-PCR",
"equipment": "Robot + Light Cycler 480",
"parameters": "Primers JF311 & JF312 Cycle: 2 - Roche Parameters-cDNA dil 1/10",
"description": "JF311-LUX-F;TGCTCATCATCTTCACAAACC\nJF312-LUX-R ;CTTCCTCTCCCATTTCAAACTC"
},
"sample_preparation": {
"method": "Samples were harvested and keeped on RNAlader for some weeks, at 4C and -20C. RNa extraction was done following protocol of GE Health Care-illustra RNAspin 96RNA Isolation kit. Samples were spect with Nanodrop. cDNA synthesis was done with Super Script Vilo kit( Invitrogene) from 1ugr RNA."
},
"samples": {
"sample": [
{
"sample_id": "1166",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1167",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1168",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1169",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1170",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1171",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1172",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1173",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1174",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1175",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1176",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1177",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1178",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1179",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1180",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1181",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1182",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1183",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1184",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1185",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1186",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1187",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1188",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1189",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1190",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1191",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1192",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1193",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1194",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1195",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1196",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1197",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1198",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1199",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1200",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1201",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1202",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1203",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1204",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1205",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1206",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1207",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1208",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1209",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1210",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1211",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1212",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1213",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1214",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1215",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1216",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1217",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1218",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1219",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1220",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1221",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1222",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1223",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1224",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1225",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1226",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1227",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1228",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1229",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1230",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1231",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1232",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1233",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1234",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1235",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1236",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1237",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1238",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1239",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1240",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1241",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1242",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1243",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1244",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1245",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1246",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1288",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1289",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1290",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1291",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1292",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1293",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1294",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1295",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1296",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1297",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1298",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1299",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1300",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1301",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1302",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1303",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1304",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1305",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1306",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1307",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1308",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1309",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1310",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1311",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1312",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1313",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1314",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1315",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1316",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1317",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1318",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1319",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1320",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1321",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1322",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1323",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1324",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1325",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1326",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1327",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1328",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1329",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1330",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1331",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1332",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1333",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1334",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1335",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1336",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1337",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1338",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1339",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1340",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1341",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1342",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1343",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1344",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1345",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1346",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1347",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1348",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1349",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1350",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1351",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1352",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1353",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1354",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1355",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1356",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1357",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1358",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1359",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1360",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1361",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1362",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1363",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1364",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1365",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1366",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1367",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1368",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1369",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1370",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1371",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1372",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1373",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1374",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1375",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1376",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1377",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1378",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1379",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1380",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1381",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1382",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1383",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1384",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1385",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1386",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1387",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1388",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1389",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1390",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1391",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1392",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1393",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1394",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1395",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1396",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1397",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1398",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1399",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1400",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1401",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1402",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1403",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1404",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1405",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1406",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1407",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1408",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1409",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1410",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1411",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1412",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1413",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1414",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1415",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1416",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1417",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1418",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1419",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1420",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1421",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1422",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1423",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1424",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1425",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1426",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1427",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1428",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1429",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1430",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1431",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1432",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1433",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1434",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1435",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1436",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1437",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1438",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1439",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1440",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1441",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1442",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1443",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1444",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1445",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1446",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1805",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1806",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1807",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1808",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1809",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1810",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1811",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1812",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1813",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1814",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1815",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1816",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1817",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1818",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1819",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1820",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1821",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1822",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1823",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1824",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1825",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1826",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1827",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1828",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1829",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1830",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1831",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1832",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1833",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1834",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1835",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1836",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1837",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1838",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1839",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1840",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1841",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1842",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1843",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1844",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1845",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1846",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1847",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1848",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1849",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1850",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1851",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1852",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1853",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1854",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1855",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1856",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1857",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1858",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1859",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1860",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1861",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1862",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1863",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1864",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1865",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1866",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1867",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1868",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1869",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1870",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1871",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1872",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1873",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1874",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1875",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1876",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1877",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1878",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1879",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1880",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1881",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1882",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1883",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1884",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1885",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1886",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1887",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1888",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1889",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1890",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1891",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1892",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1893",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1894",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1895",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1896",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1897",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1898",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1899",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1900",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1901",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1902",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1903",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1904",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1905",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1906",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1907",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1908",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1909",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1910",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1911",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1912",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1913",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1914",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1915",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1916",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1917",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1918",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1919",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1920",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1921",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1922",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1923",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1924",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1925",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1926",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1927",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1928",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1929",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1930",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1931",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1932",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1933",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1934",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1935",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1936",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1937",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1938",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1939",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1940",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1941",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1942",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1943",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1944",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1945",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1946",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1947",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1948",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1949",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1950",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1951",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1952",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1953",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1954",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1955",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1956",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1957",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1958",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1959",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1960",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "LUX",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
}
]
}
},
"biblio": {
"principal": "Karen Halliday",
"institution": "University of Edinburgh",
"author": "Aurora Pinas-Fernandez",
"curator": [
"Julia Foreman",
"Andrew Millar"
]
}
}
Creators and SubmitterCreators
Not specifiedAdditional credit
Aurora Pinas-Fernandez
Submitter
Activity
Views: 474 Downloads: 65
Created: 18th Jun 2026 at 12:19
Last updated: 18th Jun 2026 at 12:19
TagsThis item has not yet been tagged.
AttributionsNone
Version History
Version 1 (earliest) Created 18th Jun 2026 at 12:19 by Daniel Thedie
No revision comments
Download
View content
https://orcid.org/0000-0002-1352-7245