BioDare_metadata Version 1
Original BioDare metadata, converted to json format
SEEK ID: https://fairdomhub.org/data_files/8566?version=1
Filename:
BioDare_metadata.json
Format: JSON document
Size: 502 KB
{
"id": "12820606741450",
"status": "finished",
"provenance": {
"desc_version": "6",
"data_version": "3",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-08-17T16:57:54"
},
"modified": [
{
"by": "Karen Haliday",
"date": "2015-10-19T16:43:41",
"version": "6.3"
},
{
"by": "Karen Haliday",
"date": "2015-10-18T02:20:36",
"version": "5.3"
},
{
"by": "Karen Haliday",
"date": "2015-10-18T02:20:27",
"version": "5.3"
},
{
"by": "SYSTEM USER",
"date": "2014-09-15T16:54:02"
},
{
"by": "SYSTEM USER",
"date": "2014-09-08T18:30:39"
},
{
"by": "Jayne Griffiths",
"date": "2011-12-02T10:47:37"
},
{
"by": "Jayne Griffiths",
"date": "2011-12-02T10:47:22"
},
{
"by": "Jayne Griffiths",
"date": "2011-12-01T17:16:32"
},
{
"by": "Jayne Griffiths",
"date": "2011-12-01T17:14:07"
},
{
"by": "Jayne Griffiths",
"date": "2011-12-01T17:13:42"
},
{
"by": "Karen Haliday",
"date": "2011-12-01T15:25:36"
},
{
"by": "Tomasz Zielinski",
"date": "2011-05-10T19:16:48"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2011-01-13T15:58:40"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-03T18:42:10"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-02T16:13:10"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-12T13:32:48"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:42:37"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:42:19"
},
{
"by": "Aurora Pinas-Fernandez",
"date": "2010-08-17T16:57:54"
}
]
},
"description_file": {
"id": "0",
"file_type": "description file",
"original_name": "description file",
"version": [
{
"id": "7",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820606741450_dsc.7.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/12820606741450_dsc.7.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:47:37"
}
},
{
"id": "6",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820606741450_dsc.6.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/12820606741450_dsc.6.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:47:22"
}
},
{
"id": "5",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820606741450_dsc.5.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/12820606741450_dsc.5.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T17:16:32"
}
},
{
"id": "4",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820606741450_dsc.4.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/12820606741450_dsc.4.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T17:14:07"
}
},
{
"id": "3",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820606741450_dsc.3.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/12820606741450_dsc.3.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T17:13:42"
}
},
{
"id": "2",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820606741450_dsc.2.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/12820606741450_dsc.2.xml",
"uploaded": {
"by": "Tomasz Zielinski",
"date": "2011-05-10T19:16:48"
}
},
{
"id": "1",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820606741450_dsc.1.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/12820606741450_dsc.1.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2011-01-13T15:58:40"
}
},
{
"id": "0",
"file_type": "description file",
"content_type": "text/xml",
"original_name": "description file",
"local_name": "12820606741450_dsc.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/12820606741450_dsc.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-08-17T16:57:54"
}
}
]
},
"pedro_file": {
"id": "0",
"file_type": "pedro file",
"original_name": "pedro file",
"version": [
{
"id": "3",
"file_type": "pedro file",
"content_type": "text/xml",
"original_name": "Q-PCR LD 12-12 GI.xml",
"local_name": "Q-PCR LD 12-12 GI.1.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/Q-PCR LD 12-12 GI.1.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:47:22",
"version": "4"
}
},
{
"id": "2",
"file_type": "pedro file",
"content_type": "text/xml",
"original_name": "Q-PCR LD 12-12 GI.xml",
"local_name": "Q-PCR LD 12-12 GI.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/Q-PCR LD 12-12 GI.xml",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T17:13:41",
"version": "3"
}
},
{
"id": "1",
"file_type": "pedro file",
"content_type": "application/octet-stream",
"original_name": "Gi-LD-17C-OffSucrose.xml",
"local_name": "Gi-LD-17C-OffSucrose.1.xml",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/Gi-LD-17C-OffSucrose.1.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2011-01-13T15:58:40",
"version": "2"
}
},
{
"id": "0",
"file_type": "pedro file",
"content_type": "application/octet-stream",
"original_name": "Gi-LD-17C-OffSucrose.xml",
"local_name": "Gi-LD-17C-OffSucrose.xml",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/Gi-LD-17C-OffSucrose.xml",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-08-17T16:57:54",
"version": "1"
}
}
]
},
"bibliographyFile": {
"id": "0",
"file_type": "BIBLIOGRAPHY",
"original_name": "12820606741450_bibl.xml",
"version": [
{
"id": "6",
"file_type": "BIBLIOGRAPHY",
"content_type": "text/plain",
"original_name": "12820606741450_bibl.xml",
"local_name": "12820606741450_bibl.1.xml",
"local_path": "/localdisk/data/biodare/biodare3_prod/Robust/Storage/12820606741450/12820606741450_bibl.1.xml",
"uploaded": {
"by": "Karen Haliday",
"date": "2015-10-19T16:43:41",
"version": "6"
}
},
{
"id": "5",
"file_type": "BIBLIOGRAPHY",
"content_type": "text/plain",
"original_name": "12820606741450_bibl.xml",
"local_name": "12820606741450_bibl.xml",
"local_path": "/localdisk/data/biodare/biodare3_prod/Robust/Storage/12820606741450/12820606741450_bibl.xml",
"uploaded": {
"by": "Karen Haliday",
"date": "2015-10-18T02:20:27",
"version": "5"
}
}
]
},
"data_file": {
"id": "0",
"file_type": "data file",
"original_name": "2011-12 GI LD.xls",
"version": [
{
"id": "2",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "2011-12 GI LD.xls",
"local_name": "2011-12 GI LD.2.xls",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/2011-12 GI LD.2.xls",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:47:37",
"version": "3"
},
"parameter": [
{
"name": "reference_col",
"value": "2"
},
{
"name": "first_data_row",
"value": "2"
},
{
"name": "main_data_col",
"value": "8"
}
]
},
{
"id": "1",
"file_type": "data file",
"content_type": "application/octet-stream",
"original_name": "2011-12 GI LD.xls",
"local_name": "2011-12 GI LD.1.xls",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/2011-12 GI LD.1.xls",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T17:16:32",
"version": "2"
},
"parameter": [
{
"name": "reference_col",
"value": "2"
},
{
"name": "first_data_row",
"value": "2"
},
{
"name": "main_data_col",
"value": "8"
}
]
},
{
"id": "0",
"file_type": "data file",
"content_type": "application/octet-stream",
"original_name": "2011-12 GI LD.xls",
"local_name": "2011-12 GI LD.xls",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/2011-12 GI LD.xls",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-01T17:14:07",
"version": "1"
},
"parameter": [
{
"name": "reference_col",
"value": "2"
},
{
"name": "first_data_row",
"value": "2"
},
{
"name": "main_data_col",
"value": "8"
}
]
}
]
},
"std_raw_file": {
"id": "0",
"file_type": "data file",
"original_name": "STANDARD_RAWDATAFILE.txt",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "text/plain",
"original_name": "STANDARD_RAWDATAFILE.txt",
"local_name": "STANDARD_RAWDATAFILE.2.txt",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/STANDARD_RAWDATAFILE.2.txt",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:47:37"
},
"parameter": [
{
"name": "reference_col",
"value": "2"
},
{
"name": "first_data_row",
"value": "2"
},
{
"name": "main_data_col",
"value": "8"
}
]
}
},
"numeric_file": {
"id": "0",
"file_type": "data file",
"original_name": "STANDARD_DATAFILE.txt",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "text/plain",
"original_name": "STANDARD_DATAFILE.txt",
"local_name": "STANDARD_DATAFILE.2.txt",
"local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820606741450/STANDARD_DATAFILE.2.txt",
"uploaded": {
"by": "Jayne Griffiths",
"date": "2011-12-02T10:47:37"
},
"parameter": [
{
"name": "reference_col",
"value": "2"
},
{
"name": "first_data_row",
"value": "2"
},
{
"name": "main_data_col",
"value": "8"
}
]
}
},
"user_file": [
{
"id": "0",
"file_type": "user file",
"original_name": "Plate15&16-GI-200710-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plate15&16-GI-200710-Prog.xls",
"local_name": "Plate15&16-GI-200710-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/Plate15&16-GI-200710-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:42:19"
}
}
},
{
"id": "1",
"file_type": "user file",
"original_name": "Plate17-GI-260710-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plate17-GI-260710-Prog.xls",
"local_name": "Plate17-GI-260710-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/Plate17-GI-260710-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:42:19"
}
}
},
{
"id": "2",
"file_type": "user file",
"original_name": "Plate18-GI-280710-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plate18-GI-280710-Prog.xls",
"local_name": "Plate18-GI-280710-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/Plate18-GI-280710-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:42:19"
}
}
},
{
"id": "3",
"file_type": "user file",
"original_name": "Plate19&21-GI-090810-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plate19&21-GI-090810-Prog.xls",
"local_name": "Plate19&21-GI-090810-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/Plate19&21-GI-090810-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:42:37"
}
}
},
{
"id": "4",
"file_type": "user file",
"original_name": "Plate21-GI-180810-Prog.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "Plate21-GI-180810-Prog.xls",
"local_name": "Plate21-GI-180810-Prog.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/Plate21-GI-180810-Prog.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:42:37"
}
}
},
{
"id": "5",
"file_type": "user file",
"original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
"version": [
{
"id": "1",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
"local_name": "17C-LD-OS-wt-prr-gi-lc-toc.1.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/17C-LD-OS-wt-prr-gi-lc-toc.1.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-12T13:32:48"
}
},
{
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
"local_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/17C-LD-OS-wt-prr-gi-lc-toc.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-10-11T13:42:37"
}
}
]
},
{
"id": "6",
"file_type": "user file",
"original_name": "17C-LD-OS-wt-cca1.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-wt-cca1.xls",
"local_name": "17C-LD-OS-wt-cca1.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/17C-LD-OS-wt-cca1.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-02T16:13:10"
}
}
},
{
"id": "7",
"file_type": "user file",
"original_name": "17C-LD-OS-wt-lhy21.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-wt-lhy21.xls",
"local_name": "17C-LD-OS-wt-lhy21.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/17C-LD-OS-wt-lhy21.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-02T16:13:10"
}
}
},
{
"id": "8",
"file_type": "user file",
"original_name": "17C-LD-OS-lhyccagi.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-lhyccagi.xls",
"local_name": "17C-LD-OS-lhyccagi.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/17C-LD-OS-lhyccagi.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-03T18:42:10"
}
}
},
{
"id": "9",
"file_type": "user file",
"original_name": "17C-LD-OS-prr7-3.xls",
"version": {
"id": "0",
"file_type": "data file",
"content_type": "application/vnd.ms-excel",
"original_name": "17C-LD-OS-prr7-3.xls",
"local_name": "17C-LD-OS-prr7-3.xls",
"local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820606741450/17C-LD-OS-prr7-3.xls",
"uploaded": {
"by": "Aurora Pinas-Fernandez",
"date": "2010-11-03T18:42:10"
}
}
}
],
"security": {
"owner": "jgriffiths",
"supervisor": "karen",
"allowedToRead": [
"halliday",
"robust",
"public"
]
},
"open_access_info": {
"grantedBy": "karen",
"grantedOn": "2015-10-18T02:20:36",
"licence": "CC_BY"
},
"desc": {
"experiment_type": "qPCR on Robot",
"id": "12820606741450",
"status": "finished",
"name": "Q-PCR LD (12:12) 17C GI",
"purpose": "Experiment carry out to reparameterize the clock off Succrose",
"description": "Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.",
"comments": "Sample time 24h. 24h sample lost for some genotypes",
"provenance": {
"site": "Edinburgh",
"author": "Aurora Pinas-Fernandez",
"start_date": "2010-06-01"
},
"growth_condition": {
"name": "Entrainment 22C Diurnal",
"medium": "Agar 1.2% MS 0.5",
"incubation": "3 hours at 4C",
"growth_space": "Sanyo",
"duration": "7.0",
"temperature_conditions": {
"label": "const. 22.0C",
"env_conditions": {
"type": "constant_temp",
"label": "const. 22.0C",
"duration": "7",
"env_day": {
"type": "constant_temp",
"label": "constant temperature",
"duration": "7",
"cycle_length": "24",
"base_value": "22.0",
"second_value": "22.0"
}
}
},
"light_conditions": {
"label": "W: LD 12:00:12:00",
"light_channel": {
"spectrum": "white",
"intensity": "60",
"source": "tube",
"env_conditions": {
"type": "diurnal_light",
"label": "LD 12:00:12:00",
"duration": "7",
"env_day": {
"type": "diurnal_light",
"label": "diurnal light",
"duration": "7",
"cycle_length": "24",
"base_value": "0.0",
"second_value": "100.0",
"env_period": {
"start_time": "0:00",
"duration": "12:00"
}
}
}
}
}
},
"experimental_condition": {
"name": "17C LD (12:12) Off Sucrose",
"medium": "Agar 1.2% MS 0.5",
"growth_space": "Binder",
"duration": "6.0",
"exp_time_zero": "72",
"temperature_conditions": {
"label": "const. 17.0C",
"env_conditions": {
"type": "constant_temp",
"label": "const. 17.0C",
"duration": "6",
"env_day": {
"type": "constant_temp",
"label": "constant temperature",
"duration": "6",
"cycle_length": "24",
"base_value": "17.0",
"second_value": "17.0"
}
}
},
"light_conditions": {
"label": "W: LD 12:00:12:00",
"light_channel": {
"spectrum": "white",
"intensity": "60",
"source": "tube",
"env_conditions": {
"type": "diurnal_light",
"label": "LD 12:00:12:00",
"duration": "6",
"env_day": {
"type": "diurnal_light",
"label": "diurnal light",
"duration": "6",
"cycle_length": "24",
"base_value": "0.0",
"second_value": "100.0",
"env_period": {
"start_time": "0:00",
"duration": "12:00"
}
}
}
}
}
},
"measurement": {
"technique": "RT-PCR",
"equipment": "Robot + Light Cycler 480",
"parameters": "Primers JF135 & JF136 Cycle: 2 - Roche Parameters-cDNA dil 1/10",
"description": "JF135-GI-F;TATTGAAGTGTCGTCTACCAG\nJF136-GI-R:GAGCTTTGGTTCATGATATCAC",
"param": [
{
"@name": "RD reference_col",
"@value": "2"
},
{
"@name": "RD first_data_row",
"@value": "2"
},
{
"@name": "RD main_data_col",
"@value": "8"
}
]
},
"sample_preparation": {
"method": "Samples were harvested and keeped on RNAlader for some weeks, at 4C and -20C. RNa extraction was done following protocol of GE Health Care-illustra RNAspin 96RNA Isolation kit. Samples were spect with Nanodrop. cDNA synthesis was done with Super Script Vilo kit( Invitrogene) from 1ugr RNA."
},
"samples": {
"sample": [
{
"sample_id": "1166",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1167",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1168",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1169",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1170",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1171",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1172",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1173",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1174",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1175",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1176",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1177",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1178",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1179",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1180",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1181",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1182",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1183",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1184",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1185",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1186",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1187",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1188",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1189",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1190",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1191",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1192",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1193",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1194",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1195",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1196",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1197",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1198",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1199",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1200",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1201",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1202",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1203",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1204",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1205",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1206",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1207",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1208",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1209",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1210",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1211",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1212",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1213",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1214",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1215",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1216",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1217",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1218",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1219",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1220",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1221",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1222",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1223",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1224",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1225",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1226",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1227",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1228",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1229",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1230",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1231",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1232",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1233",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1234",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1235",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1236",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1237",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1238",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1239",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1240",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1241",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1242",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1243",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1244",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1245",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1246",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1288",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1289",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1290",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1291",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1292",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1293",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1294",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1295",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1296",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1297",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1298",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1299",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1300",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1301",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1302",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1303",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1304",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1305",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1306",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1307",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1308",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1309",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1310",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1311",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1312",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1313",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1314",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1315",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1316",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1317",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1318",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1319",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1320",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1321",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1322",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1323",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1324",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1325",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1326",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1327",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1328",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1329",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1330",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1331",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1332",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1333",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1334",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1335",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1336",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1337",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1338",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1339",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1340",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1341",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1342",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1343",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1344",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1345",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1346",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1347",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1348",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1349",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1350",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1351",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1352",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1353",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1354",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1355",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1356",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1357",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1358",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1359",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1360",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1361",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1362",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1363",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1364",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1365",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1366",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1367",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1368",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1369",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1370",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1371",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1372",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1373",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1374",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1375",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1376",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1377",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1378",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1379",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1380",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1381",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1382",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1383",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1384",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1385",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1386",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1387",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1388",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1389",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1390",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1391",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1392",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1393",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1394",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1395",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1396",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1397",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1398",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1399",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1400",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1401",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1402",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1403",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1404",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1405",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1406",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1407",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1408",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1409",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1410",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1411",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1412",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1413",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1414",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1415",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1416",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1417",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1418",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1419",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1420",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1421",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1422",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1423",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1424",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1425",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1426",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1427",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1428",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1429",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1430",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1431",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1432",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1433",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1434",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1435",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1436",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1437",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1438",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1439",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1440",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1441",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1442",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1443",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1444",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1445",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1446",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1805",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1806",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1807",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1808",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1809",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1810",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1811",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1812",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1813",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1814",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1815",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1816",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1817",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1818",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1819",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1820",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1821",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1822",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1823",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1824",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1825",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1826",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1827",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1828",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1829",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1830",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1831",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1832",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1833",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1834",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1835",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1836",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1837",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1838",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1839",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1840",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1841",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1842",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1843",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1844",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1845",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1846",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1847",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1848",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1849",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1850",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1851",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1852",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1853",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1854",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1855",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1856",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1857",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1858",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1859",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1860",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1861",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1862",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1863",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1864",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1865",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1866",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1867",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1868",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1869",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1870",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1871",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1872",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1873",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1874",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1875",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1876",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1877",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1878",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1879",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1880",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1881",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1882",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1883",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1884",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1885",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1886",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1887",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1888",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1889",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1890",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1891",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1892",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1893",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1894",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1895",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1896",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1897",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1898",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1899",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1900",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1901",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1902",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1903",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1904",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1905",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1906",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1907",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1908",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1909",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1910",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1911",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1912",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1913",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1914",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1915",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1916",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1917",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1918",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1919",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1920",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1921",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1922",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1923",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1924",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00",
"ignored": "false"
},
{
"sample_id": "1925",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1926",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1927",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00",
"ignored": "false"
},
{
"sample_id": "1928",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1929",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1930",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00",
"ignored": "false"
},
{
"sample_id": "1931",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1932",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1933",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00",
"ignored": "false"
},
{
"sample_id": "1934",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1935",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1936",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00",
"ignored": "false"
},
{
"sample_id": "1937",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1938",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1939",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00",
"ignored": "false"
},
{
"sample_id": "1940",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1941",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1942",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00",
"ignored": "false"
},
{
"sample_id": "1943",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1944",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1945",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00",
"ignored": "false"
},
{
"sample_id": "1946",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1947",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1948",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00",
"ignored": "false"
},
{
"sample_id": "1949",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1950",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1951",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00",
"ignored": "false"
},
{
"sample_id": "1952",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1953",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1954",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00",
"ignored": "false"
},
{
"sample_id": "1955",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1956",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1957",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00",
"ignored": "false"
},
{
"sample_id": "1958",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1959",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
},
{
"sample_id": "1960",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"line": "unknown",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00",
"ignored": "false"
}
]
}
},
"pedro": {
"@xmlns:xsi": "http://www.w3.org/2001/XMLSchema-instance",
"@xsi:schemaLocation": "/W:/ROBuST/DataDescription/models/pcr/model/pcr_model.xsd",
"status": "finished",
"name": "Q-PCR LD (12:12) 17C GI",
"purpose": "Experiment carry out to reparameterize the clock off Succrose",
"description": "Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.",
"comments": "Sample time 24h. 24h sample lost for some genotypes",
"provenance": {
"site": "Edinburgh",
"author": "Aurora Pinas-Fernandez",
"start_date": "2010-06-01"
},
"growth_condition": {
"name": "Entrainment 22C Diurnal",
"medium": "Agar 1.2% MS 0.5",
"incubation": "3 hours at 4C",
"growth_space": "Sanyo",
"duration": "7",
"temperature_conditions": {
"constant_temp": {
"cycle_length": "24",
"base_temp": "22"
}
},
"light_conditions": {
"light_channel": {
"spectrum": "white",
"intensity": "60",
"source": "tube",
"diurnal_light": {
"cycle_length": "24",
"start_time": "0",
"duration": "12"
}
}
}
},
"experimental_condition": {
"name": "17C LD (12:12) Off Sucrose",
"medium": "Agar 1.2% MS 0.5",
"growth_space": "Binder",
"duration": "6",
"exp_time_zero": "72",
"temperature_conditions": {
"constant_temp": {
"cycle_length": "24",
"base_temp": "17"
}
},
"light_conditions": {
"light_channel": {
"spectrum": "white",
"intensity": "60",
"source": "tube",
"diurnal_light": {
"cycle_length": "24",
"start_time": "0",
"duration": "12"
}
}
}
},
"measurement": {
"technique": "RT-PCR",
"equipment": "Robot + Light Cycler 480",
"parameters": "Primers JF135 & JF136 Cycle: 2 - Roche Parameters-cDNA dil 1/10",
"description": "JF135-GI-F;TATTGAAGTGTCGTCTACCAG\nJF136-GI-R:GAGCTTTGGTTCATGATATCAC"
},
"sample_preparation": {
"method": "Samples were harvested and keeped on RNAlader for some weeks, at 4C and -20C. RNa extraction was done following protocol of GE Health Care-illustra RNAspin 96RNA Isolation kit. Samples were spect with Nanodrop. cDNA synthesis was done with Super Script Vilo kit( Invitrogene) from 1ugr RNA."
},
"samples": {
"sample": [
{
"sample_id": "1166",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1167",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1168",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1169",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1170",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1171",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1172",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1173",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1174",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1175",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1176",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1177",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1178",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1179",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1180",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1181",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1182",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1183",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1184",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1185",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1186",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1187",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1188",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1189",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1190",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1191",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1192",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1193",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1194",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1195",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1196",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1197",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1198",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1199",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1200",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1201",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1202",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1203",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1204",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1205",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1206",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1207",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1208",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1209",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1210",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1211",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1212",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1213",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1214",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1215",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1216",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1217",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1218",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1219",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1220",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1221",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1222",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1223",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1224",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1225",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1226",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1227",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1228",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1229",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1230",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1231",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1232",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1233",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1234",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1235",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1236",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1237",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1238",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1239",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1240",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1241",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1242",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1243",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1244",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1245",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1246",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "toc1 -9",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1288",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1289",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1290",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1291",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1292",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1293",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1294",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1295",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1296",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1297",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1298",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1299",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1300",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1301",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1302",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1303",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1304",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1305",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1306",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1307",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1308",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1309",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1310",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1311",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1312",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1313",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1314",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1315",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1316",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1317",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1318",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1319",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1320",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1321",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1322",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1323",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1324",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1325",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1326",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1327",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1328",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1329",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1330",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1331",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1332",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1333",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1334",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1335",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1336",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1337",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1338",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1339",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1340",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1341",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1342",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1343",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1344",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1345",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1346",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1347",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1348",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1349",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1350",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1351",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1352",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1353",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1354",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1355",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1356",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1357",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1358",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1359",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1360",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1361",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1362",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1363",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1364",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1365",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1366",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1367",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1368",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1369",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1370",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1371",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1372",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1373",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1374",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1375",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1376",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1377",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1378",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1379",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1380",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1381",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1382",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1383",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1384",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1385",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1386",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1387",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1388",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1389",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1390",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1391",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1392",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1393",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1394",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1395",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1396",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1397",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1398",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1399",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1400",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1401",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1402",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1403",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1404",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1405",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1406",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1407",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1408",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1409",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1410",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1411",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1412",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1413",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1414",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1415",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1416",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1417",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1418",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1419",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1420",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1421",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1422",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1423",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1424",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1425",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1426",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1427",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1428",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1429",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1430",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1431",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1432",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1433",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1434",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1435",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1436",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1437",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1438",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1439",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1440",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1441",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1442",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1443",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1444",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1445",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1446",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Wasilewski (WS)",
"genotype": "lhy-21 cca1 gi-11",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1805",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1806",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1807",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1808",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1809",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1810",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1811",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1812",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1813",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1814",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1815",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1816",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1817",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1818",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1819",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1820",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1821",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1822",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1823",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1824",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1825",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1826",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1827",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1828",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1829",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1830",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1831",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1832",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1833",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1834",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1835",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1836",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1837",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1838",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1839",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1840",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1841",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1842",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1843",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "Wild Type",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1844",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1845",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1846",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1847",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1848",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1849",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1850",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1851",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1852",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1853",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1854",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1855",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1856",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1857",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1858",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1859",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1860",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1861",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1862",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1863",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1864",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1865",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1866",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1867",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1868",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1869",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1870",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1871",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1872",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1873",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1874",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1875",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1876",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1877",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1878",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1879",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1880",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1881",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1882",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1883",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1884",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1885",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1886",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1887",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1888",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1889",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1890",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1891",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1892",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1893",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1894",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1895",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1896",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1897",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1898",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1899",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1900",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1901",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1902",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1903",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1904",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1905",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1906",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1907",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1908",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1909",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1910",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1911",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1912",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1913",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1914",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1915",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1916",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1917",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1918",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1919",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1920",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1921",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1922",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1923",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1924",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "0.00"
},
{
"sample_id": "1925",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1926",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1927",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "2.00"
},
{
"sample_id": "1928",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1929",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1930",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "4.00"
},
{
"sample_id": "1931",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1932",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1933",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "6.00"
},
{
"sample_id": "1934",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1935",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1936",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "8.00"
},
{
"sample_id": "1937",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1938",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1939",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "10.00"
},
{
"sample_id": "1940",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1941",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1942",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "12.00"
},
{
"sample_id": "1943",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1944",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1945",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "14.00"
},
{
"sample_id": "1946",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1947",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1948",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "16.00"
},
{
"sample_id": "1949",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1950",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1951",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "18.00"
},
{
"sample_id": "1952",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1953",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1954",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "20.00"
},
{
"sample_id": "1955",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1956",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1957",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "22.00"
},
{
"sample_id": "1958",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1959",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
},
{
"sample_id": "1960",
"sample_type": "RNA extract",
"origin": "whole seedling",
"growth_stage": "seedling",
"age": "13",
"genetic_info": {
"species": "Arabidopsis thaliana",
"background": "Columbia (Col)",
"genotype": "prr7-3 prr9-1",
"provenance": "Robust stock"
},
"marker": "GI",
"growth_cond_name": "Entrainment 22C Diurnal",
"experiment_cond_name": "17C LD (12:12) Off Sucrose",
"collection_time": "24.00"
}
]
}
},
"biblio": {
"principal": "Karen Halliday",
"institution": "University of Edinburgh",
"author": "Aurora Pinas-Fernandez",
"curator": [
"Julia Foreman",
"Andrew Millar"
]
}
}
Export PNG
Creators and Submitter
Activity
Views: 88 Downloads: 2
Created: 18th Jun 2026 at 12:13
Last updated: 18th Jun 2026 at 12:13
TagsThis item has not yet been tagged.
AttributionsNone
Version History
Version 1 (earliest) Created 18th Jun 2026 at 12:13 by Daniel Thedie
No revision comments
Related items
Advanced People list for this Data file with search and filtering
https://orcid.org/0000-0002-1352-7245Research Software Engineer in the Biological Research Data Management team (BioRDM) at the University of Edinburgh.
Advanced Programmes list for this Data file with search and filtering
The Centre for Engineering Biology is the University of Edinburgh's research organisation in interdisciplinary, Synthetic and Systems Biology, founded in 2023 as the successor to SynthSys, itself founded in 2012 as the successor to the Centre for Systems Biology at Edinburgh (CSBE). CSBE was newly founded in 2007. The Centre for Engineering Biology is a hub organisation that links across multiple, major funding awards, including an Engineering Biology Mission Hub, and EPSRC C-loop.
Projects: Millar group, PHYTOCAL: Phytochrome Control of Resource Allocation and Growth in Arabidopsis and in Brassicaceae crops, TiMet, POP - the Parameter Optimisation Problem, Regulation of flowering time in natural conditions, PlaSMo model repository, BioDare1
Web page: https://biology.ed.ac.uk/centre-engineering-biology
Advanced Projects list for this Data file with search and filtering
Experiment data previously hosted on the original version of BioDare (biodare.ed.ac.uk).
Programme: Centre for Engineering Biology (prev. SynthSys)
Public web page: Not specified
Advanced Investigations list for this Data file with search and filtering
Collection of experiments created by Flis Anna on the original BioDare and automatically transferred to FAIRDOM Hub.
Submitter: Daniel Thedie
Studies: Flis et al. (2015), Flis et al. (2016), Unpublished
Assays: Clock gene RNAs under RD-RR in clock mutants, expt 1, Clock gene RNAs under RD-RR in clock mutants, expt 2, Clock gene RNAs under RD-RR in clock mutants, expt 3, Clock gene RNAs under RD-RR in clock mutants, expt 4, Flis et al. TiMet clock gene comparison across photoperiods, McWatters A.t. Col-0 WT clock RNA timeseries, Q-PCR LD (12:12) 17C CAB2, Q-PCR LD (12:12) 17C CCA1, Q-PCR LD (12:12) 17C ELF3, Q-PCR LD (12:12) 17C ELF4, Q-PCR LD (12:12) 17C GI, Q-PCR LD (12:12) 17C LHY, Q-PCR LD (12:12) 17C LUX, Q-PCR LD (12:12) 17C PRR5, Q-PCR LD (12:12) 17C PRR7, Q-PCR LD (12:12) 17C PRR9, Q-PCR LD (12:12) 17C TOC1, TiMet WP1.1 WS seedling vs rosette, TiMet WP1.1 qRT-PCR LD to LL and LD, TiMet WP1.1 qRT-PCR elf3 LD
Advanced Studies list for this Data file with search and filtering
Defining the robust behaviour of the plant clock gene circuit with absolute RNA timeseries and open infrastructure
Flis et al. (2015)
DOI: 10.1098/rsob.150042
Submitter: Daniel Thedie
Investigation: Flis Anna
Assays: Clock gene RNAs under RD-RR in clock mutants, expt 1, Clock gene RNAs under RD-RR in clock mutants, expt 2, Clock gene RNAs under RD-RR in clock mutants, expt 3, Clock gene RNAs under RD-RR in clock mutants, expt 4, McWatters A.t. Col-0 WT clock RNA timeseries, Q-PCR LD (12:12) 17C CAB2, Q-PCR LD (12:12) 17C CCA1, Q-PCR LD (12:12) 17C ELF3, Q-PCR LD (12:12) 17C ELF4, Q-PCR LD (12:12) 17C GI, Q-PCR LD (12:12) 17C LHY, Q-PCR LD (12:12) 17C LUX, Q-PCR LD (12:12) 17C PRR5, Q-PCR LD (12:12) 17C PRR7, Q-PCR LD (12:12) 17C PRR9, Q-PCR LD (12:12) 17C TOC1, TiMet WP1.1 WS seedling vs rosette, TiMet WP1.1 qRT-PCR LD to LL and LD, TiMet WP1.1 qRT-PCR elf3 LD
Advanced Assays list for this Data file with search and filtering
Q-PCR LD (12:12) 17C GI
| Property | Value |
|---|---|
| BioDare ID | 12820606741450 |
| Author | Aurora Pinas-Fernandez |
| Institution | University of Edinburgh |
| License | CC_BY |
Description
Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.
Purpose
Experiment carry out to reparameterize the clock off Succrose
Comments
Sample time 24h. 24h ...
Submitter: Daniel Thedie
Assay type: Experimental Assay Type
Technology type: Technology Type
Investigation: Flis Anna
Study: Flis et al. (2015)
