BioDare_metadata.json
Version 1

Original BioDare metadata, converted to json format

SEEK ID: https://fairdomhub.org/data_files/8547?version=1

Filename: BioDare_metadata.json  Download

Format: JSON document

Size: 501 KB

{
  "id": "12820611587928",
  "status": "finished",
  "provenance": {
    "desc_version": "6",
    "data_version": "2",
    "uploaded": {
      "by": "Aurora Pinas-Fernandez",
      "date": "2010-08-17T17:05:58"
    },
    "modified": [
      {
        "by": "Karen Haliday",
        "date": "2015-10-19T16:45:14",
        "version": "6.2"
      },
      {
        "by": "Karen Haliday",
        "date": "2015-10-18T02:19:35",
        "version": "5.2"
      },
      {
        "by": "Karen Haliday",
        "date": "2015-10-18T02:19:16",
        "version": "5.2"
      },
      {
        "by": "SYSTEM USER",
        "date": "2014-09-15T16:54:02"
      },
      {
        "by": "SYSTEM USER",
        "date": "2014-09-08T18:30:39"
      },
      {
        "by": "Jayne Griffiths",
        "date": "2011-12-02T10:44:52"
      },
      {
        "by": "Jayne Griffiths",
        "date": "2011-12-02T10:35:44"
      },
      {
        "by": "Jayne Griffiths",
        "date": "2011-12-02T10:35:20"
      },
      {
        "by": "Karen Haliday",
        "date": "2011-12-01T15:24:53"
      },
      {
        "by": "Tomasz Zielinski",
        "date": "2011-05-10T19:16:48"
      },
      {
        "by": "Aurora Pinas-Fernandez",
        "date": "2011-01-13T16:01:14"
      },
      {
        "by": "Aurora Pinas-Fernandez",
        "date": "2010-11-03T18:40:28"
      },
      {
        "by": "Aurora Pinas-Fernandez",
        "date": "2010-11-03T14:28:01"
      },
      {
        "by": "Aurora Pinas-Fernandez",
        "date": "2010-11-02T16:10:37"
      },
      {
        "by": "Aurora Pinas-Fernandez",
        "date": "2010-10-12T13:34:41"
      },
      {
        "by": "Aurora Pinas-Fernandez",
        "date": "2010-10-11T13:19:12"
      },
      {
        "by": "Aurora Pinas-Fernandez",
        "date": "2010-10-11T13:18:46"
      },
      {
        "by": "Aurora Pinas-Fernandez",
        "date": "2010-10-11T13:18:02"
      },
      {
        "by": "Aurora Pinas-Fernandez",
        "date": "2010-08-17T17:05:58"
      }
    ]
  },
  "description_file": {
    "id": "0",
    "file_type": "description file",
    "original_name": "description file",
    "version": [
      {
        "id": "5",
        "file_type": "description file",
        "content_type": "text/xml",
        "original_name": "description file",
        "local_name": "12820611587928_dsc.5.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/12820611587928_dsc.5.xml",
        "uploaded": {
          "by": "Jayne Griffiths",
          "date": "2011-12-02T10:44:52"
        }
      },
      {
        "id": "4",
        "file_type": "description file",
        "content_type": "text/xml",
        "original_name": "description file",
        "local_name": "12820611587928_dsc.4.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/12820611587928_dsc.4.xml",
        "uploaded": {
          "by": "Jayne Griffiths",
          "date": "2011-12-02T10:35:44"
        }
      },
      {
        "id": "3",
        "file_type": "description file",
        "content_type": "text/xml",
        "original_name": "description file",
        "local_name": "12820611587928_dsc.3.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/12820611587928_dsc.3.xml",
        "uploaded": {
          "by": "Jayne Griffiths",
          "date": "2011-12-02T10:35:20"
        }
      },
      {
        "id": "2",
        "file_type": "description file",
        "content_type": "text/xml",
        "original_name": "description file",
        "local_name": "12820611587928_dsc.2.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/12820611587928_dsc.2.xml",
        "uploaded": {
          "by": "Tomasz Zielinski",
          "date": "2011-05-10T19:16:48"
        }
      },
      {
        "id": "1",
        "file_type": "description file",
        "content_type": "text/xml",
        "original_name": "description file",
        "local_name": "12820611587928_dsc.1.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/12820611587928_dsc.1.xml",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2011-01-13T16:01:14"
        }
      },
      {
        "id": "0",
        "file_type": "description file",
        "content_type": "text/xml",
        "original_name": "description file",
        "local_name": "12820611587928_dsc.xml",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/12820611587928_dsc.xml",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-08-17T17:05:58"
        }
      }
    ]
  },
  "pedro_file": {
    "id": "0",
    "file_type": "pedro file",
    "original_name": "pedro file",
    "version": [
      {
        "id": "3",
        "file_type": "pedro file",
        "content_type": "text/xml",
        "original_name": "Q-PCR LD 12-12 TOC1.xml",
        "local_name": "Q-PCR LD 12-12 TOC1.1.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/Q-PCR LD 12-12 TOC1.1.xml",
        "uploaded": {
          "by": "Jayne Griffiths",
          "date": "2011-12-02T10:44:52",
          "version": "4"
        }
      },
      {
        "id": "2",
        "file_type": "pedro file",
        "content_type": "text/xml",
        "original_name": "Q-PCR LD 12-12 TOC1.xml",
        "local_name": "Q-PCR LD 12-12 TOC1.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/Q-PCR LD 12-12 TOC1.xml",
        "uploaded": {
          "by": "Jayne Griffiths",
          "date": "2011-12-02T10:35:20",
          "version": "3"
        }
      },
      {
        "id": "1",
        "file_type": "pedro file",
        "content_type": "application/octet-stream",
        "original_name": "toc1-17c-LD-OffSuc.xml",
        "local_name": "toc1-17c-LD-OffSuc.1.xml",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/toc1-17c-LD-OffSuc.1.xml",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2011-01-13T16:01:14",
          "version": "2"
        }
      },
      {
        "id": "0",
        "file_type": "pedro file",
        "content_type": "application/octet-stream",
        "original_name": "toc1-17c-LD-OffSuc.xml",
        "local_name": "toc1-17c-LD-OffSuc.xml",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/toc1-17c-LD-OffSuc.xml",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-08-17T17:05:58",
          "version": "1"
        }
      }
    ]
  },
  "bibliographyFile": {
    "id": "0",
    "file_type": "BIBLIOGRAPHY",
    "original_name": "12820611587928_bibl.xml",
    "version": [
      {
        "id": "6",
        "file_type": "BIBLIOGRAPHY",
        "content_type": "text/plain",
        "original_name": "12820611587928_bibl.xml",
        "local_name": "12820611587928_bibl.1.xml",
        "local_path": "/localdisk/data/biodare/biodare3_prod/Robust/Storage/12820611587928/12820611587928_bibl.1.xml",
        "uploaded": {
          "by": "Karen Haliday",
          "date": "2015-10-19T16:45:14",
          "version": "6"
        }
      },
      {
        "id": "5",
        "file_type": "BIBLIOGRAPHY",
        "content_type": "text/plain",
        "original_name": "12820611587928_bibl.xml",
        "local_name": "12820611587928_bibl.xml",
        "local_path": "/localdisk/data/biodare/biodare3_prod/Robust/Storage/12820611587928/12820611587928_bibl.xml",
        "uploaded": {
          "by": "Karen Haliday",
          "date": "2015-10-18T02:19:16",
          "version": "5"
        }
      }
    ]
  },
  "data_file": {
    "id": "0",
    "file_type": "data file",
    "original_name": "Plt15&16-TOC-200710-Prog.xls",
    "version": [
      {
        "id": "1",
        "file_type": "data file",
        "content_type": "application/octet-stream",
        "original_name": "2011-12 TOC1 LD.xls",
        "local_name": "2011-12 TOC1 LD.xls",
        "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/2011-12 TOC1 LD.xls",
        "uploaded": {
          "by": "Jayne Griffiths",
          "date": "2011-12-02T10:35:44",
          "version": "2"
        },
        "parameter": [
          {
            "name": "reference_col",
            "value": "2"
          },
          {
            "name": "first_data_row",
            "value": "2"
          },
          {
            "name": "main_data_col",
            "value": "8"
          }
        ]
      },
      {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "Plt15&16-TOC-200710-Prog.xls",
        "local_name": "Plt15&16-TOC-200710-Prog.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/Plt15&16-TOC-200710-Prog.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-10-11T13:18:02",
          "version": "1"
        },
        "parameter": {
          "name": "converted",
          "value": "false"
        }
      }
    ]
  },
  "std_raw_file": {
    "id": "0",
    "file_type": "data file",
    "original_name": "STANDARD_RAWDATAFILE.txt",
    "version": {
      "id": "0",
      "file_type": "data file",
      "content_type": "text/plain",
      "original_name": "STANDARD_RAWDATAFILE.txt",
      "local_name": "STANDARD_RAWDATAFILE.txt",
      "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/STANDARD_RAWDATAFILE.txt",
      "uploaded": {
        "by": "Jayne Griffiths",
        "date": "2011-12-02T10:35:44"
      },
      "parameter": [
        {
          "name": "reference_col",
          "value": "2"
        },
        {
          "name": "first_data_row",
          "value": "2"
        },
        {
          "name": "main_data_col",
          "value": "8"
        }
      ]
    }
  },
  "numeric_file": {
    "id": "0",
    "file_type": "data file",
    "original_name": "STANDARD_DATAFILE.txt",
    "version": {
      "id": "0",
      "file_type": "data file",
      "content_type": "text/plain",
      "original_name": "STANDARD_DATAFILE.txt",
      "local_name": "STANDARD_DATAFILE.txt",
      "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611587928/STANDARD_DATAFILE.txt",
      "uploaded": {
        "by": "Jayne Griffiths",
        "date": "2011-12-02T10:35:44"
      },
      "parameter": [
        {
          "name": "reference_col",
          "value": "2"
        },
        {
          "name": "first_data_row",
          "value": "2"
        },
        {
          "name": "main_data_col",
          "value": "8"
        }
      ]
    }
  },
  "user_file": [
    {
      "id": "0",
      "file_type": "user file",
      "original_name": "Plt15&16-TOC-200710-Prog.xls",
      "version": {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "Plt15&16-TOC-200710-Prog.xls",
        "local_name": "Plt15&16-TOC-200710-Prog.1.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/Plt15&16-TOC-200710-Prog.1.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-10-11T13:18:46"
        }
      }
    },
    {
      "id": "1",
      "file_type": "user file",
      "original_name": "Plt17-TOC-260710-Prog.xls",
      "version": {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "Plt17-TOC-260710-Prog.xls",
        "local_name": "Plt17-TOC-260710-Prog.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/Plt17-TOC-260710-Prog.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-10-11T13:18:46"
        }
      }
    },
    {
      "id": "2",
      "file_type": "user file",
      "original_name": "Plt18-TOC-280710-Prog.xls",
      "version": {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "Plt18-TOC-280710-Prog.xls",
        "local_name": "Plt18-TOC-280710-Prog.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/Plt18-TOC-280710-Prog.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-10-11T13:18:46"
        }
      }
    },
    {
      "id": "3",
      "file_type": "user file",
      "original_name": "Plt19&20-TOC-090810-Prog.xls",
      "version": {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "Plt19&20-TOC-090810-Prog.xls",
        "local_name": "Plt19&20-TOC-090810-Prog.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/Plt19&20-TOC-090810-Prog.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-10-11T13:19:12"
        }
      }
    },
    {
      "id": "4",
      "file_type": "user file",
      "original_name": "Plt21-TOC-180810-Prog.xls",
      "version": {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "Plt21-TOC-180810-Prog.xls",
        "local_name": "Plt21-TOC-180810-Prog.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/Plt21-TOC-180810-Prog.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-10-11T13:19:12"
        }
      }
    },
    {
      "id": "5",
      "file_type": "user file",
      "original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
      "version": [
        {
          "id": "1",
          "file_type": "data file",
          "content_type": "application/vnd.ms-excel",
          "original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
          "local_name": "17C-LD-OS-wt-prr-gi-lc-toc.1.xls",
          "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/17C-LD-OS-wt-prr-gi-lc-toc.1.xls",
          "uploaded": {
            "by": "Aurora Pinas-Fernandez",
            "date": "2010-10-12T13:34:41"
          }
        },
        {
          "id": "0",
          "file_type": "data file",
          "content_type": "application/vnd.ms-excel",
          "original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
          "local_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls",
          "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/17C-LD-OS-wt-prr-gi-lc-toc.xls",
          "uploaded": {
            "by": "Aurora Pinas-Fernandez",
            "date": "2010-10-11T13:19:12"
          }
        }
      ]
    },
    {
      "id": "6",
      "file_type": "user file",
      "original_name": "17C-LD-OS-wt-cca1.xls",
      "version": {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "17C-LD-OS-wt-cca1.xls",
        "local_name": "17C-LD-OS-wt-cca1.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/17C-LD-OS-wt-cca1.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-11-02T16:10:36"
        }
      }
    },
    {
      "id": "7",
      "file_type": "user file",
      "original_name": "17C-LD-OS-wt-lhy21.xls",
      "version": {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "17C-LD-OS-wt-lhy21.xls",
        "local_name": "17C-LD-OS-wt-lhy21.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/17C-LD-OS-wt-lhy21.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-11-02T16:10:36"
        }
      }
    },
    {
      "id": "8",
      "file_type": "user file",
      "original_name": "17C-LD-OS-lhyccagi.xls",
      "version": {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "17C-LD-OS-lhyccagi.xls",
        "local_name": "17C-LD-OS-lhyccagi.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/17C-LD-OS-lhyccagi.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-11-03T14:28:01"
        }
      }
    },
    {
      "id": "9",
      "file_type": "user file",
      "original_name": "17C-LD-OS-prr7-3.xls",
      "version": {
        "id": "0",
        "file_type": "data file",
        "content_type": "application/vnd.ms-excel",
        "original_name": "17C-LD-OS-prr7-3.xls",
        "local_name": "17C-LD-OS-prr7-3.xls",
        "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611587928/17C-LD-OS-prr7-3.xls",
        "uploaded": {
          "by": "Aurora Pinas-Fernandez",
          "date": "2010-11-03T18:40:27"
        }
      }
    }
  ],
  "security": {
    "owner": "jgriffiths",
    "supervisor": "karen",
    "allowedToRead": [
      "halliday",
      "robust",
      "public"
    ]
  },
  "open_access_info": {
    "grantedBy": "karen",
    "grantedOn": "2015-10-18T02:19:35",
    "licence": "CC_BY"
  },
  "desc": {
    "experiment_type": "qPCR on Robot",
    "id": "12820611587928",
    "status": "finished",
    "name": "Q-PCR LD (12:12) 17C TOC1",
    "purpose": "Experiment carry out to reparameterize the clock off Succrose",
    "description": "Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.",
    "comments": "Sample time 24h. 24h sample lost for some genotypes",
    "provenance": {
      "site": "Edinburgh",
      "author": "Aurora Pinas-Fernandez",
      "start_date": "2010-06-01"
    },
    "growth_condition": {
      "name": "Entrainment 22C Diurnal",
      "medium": "Agar 1.2% MS 0.5",
      "incubation": "3 hours at 4C",
      "growth_space": "Sanyo",
      "duration": "7.0",
      "temperature_conditions": {
        "label": "const. 22.0C",
        "env_conditions": {
          "type": "constant_temp",
          "label": "const. 22.0C",
          "duration": "7",
          "env_day": {
            "type": "constant_temp",
            "label": "constant temperature",
            "duration": "7",
            "cycle_length": "24",
            "base_value": "22.0",
            "second_value": "22.0"
          }
        }
      },
      "light_conditions": {
        "label": "W: LD 12:00:12:00",
        "light_channel": {
          "spectrum": "white",
          "intensity": "60",
          "source": "tube",
          "env_conditions": {
            "type": "diurnal_light",
            "label": "LD 12:00:12:00",
            "duration": "7",
            "env_day": {
              "type": "diurnal_light",
              "label": "diurnal light",
              "duration": "7",
              "cycle_length": "24",
              "base_value": "0.0",
              "second_value": "100.0",
              "env_period": {
                "start_time": "0:00",
                "duration": "12:00"
              }
            }
          }
        }
      }
    },
    "experimental_condition": {
      "name": "17C LD (12:12) Off Sucrose",
      "medium": "Agar 1.2% MS 0.5",
      "growth_space": "Binder",
      "duration": "6.0",
      "exp_time_zero": "72",
      "temperature_conditions": {
        "label": "const. 17.0C",
        "env_conditions": {
          "type": "constant_temp",
          "label": "const. 17.0C",
          "duration": "6",
          "env_day": {
            "type": "constant_temp",
            "label": "constant temperature",
            "duration": "6",
            "cycle_length": "24",
            "base_value": "17.0",
            "second_value": "17.0"
          }
        }
      },
      "light_conditions": {
        "label": "W: LD 12:00:12:00",
        "light_channel": {
          "spectrum": "white",
          "intensity": "60",
          "source": "tube",
          "env_conditions": {
            "type": "diurnal_light",
            "label": "LD 12:00:12:00",
            "duration": "6",
            "env_day": {
              "type": "diurnal_light",
              "label": "diurnal light",
              "duration": "6",
              "cycle_length": "24",
              "base_value": "0.0",
              "second_value": "100.0",
              "env_period": {
                "start_time": "0:00",
                "duration": "12:00"
              }
            }
          }
        }
      }
    },
    "measurement": {
      "technique": "RT-PCR",
      "equipment": "Robot + Light Cycler 480",
      "parameters": "Primers JF116 & JF117 Cycle: 2 - Roche Parameters-cDNA dil 1/10",
      "description": "JF116-TOC1-F;ATCTTCGCAGAATCCCTGTGATA\nJF117-TOC1-R;GCACCTAGCTTCAAGCACTTTACA"
    },
    "sample_preparation": {
      "method": "Samples were harvested and keeped on RNAlader for some weeks, at 4C and -20C. RNa extraction was done following protocol of GE Health Care-illustra RNAspin 96RNA Isolation kit. Samples were spect with Nanodrop. cDNA synthesis was done with Super Script Vilo kit( Invitrogene) from 1ugr RNA."
    },
    "samples": {
      "sample": [
        {
          "sample_id": "1166",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1167",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1168",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1169",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1170",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1171",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1172",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1173",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1174",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1175",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1176",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1177",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1178",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1179",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1180",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1181",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1182",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1183",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1184",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1185",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1186",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1187",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1188",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1189",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1190",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1191",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1192",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1193",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1194",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1195",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1196",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1197",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1198",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1199",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1200",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1201",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1202",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1203",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1204",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1205",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1206",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1207",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1208",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1209",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1210",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1211",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1212",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1213",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1214",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1215",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1216",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1217",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1218",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1219",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1220",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1221",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1222",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1223",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1224",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1225",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1226",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1227",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1228",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1229",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1230",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1231",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1232",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1233",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1234",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1235",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1236",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1237",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1238",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1239",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1240",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1241",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1242",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1243",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1244",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1245",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1246",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1288",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1289",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1290",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1291",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1292",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1293",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1294",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1295",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1296",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1297",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1298",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1299",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1300",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1301",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1302",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1303",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1304",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1305",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1306",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1307",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1308",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1309",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1310",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1311",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1312",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1313",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1314",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1315",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1316",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1317",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1318",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1319",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1320",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1321",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1322",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1323",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1324",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1325",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1326",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1327",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1328",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1329",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1330",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1331",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1332",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1333",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1334",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1335",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1336",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1337",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1338",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1339",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1340",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1341",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1342",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1343",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1344",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1345",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1346",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1347",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1348",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1349",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1350",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1351",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1352",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1353",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1354",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1355",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1356",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1357",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1358",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1359",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1360",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1361",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1362",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1363",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1364",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1365",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1366",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1367",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1368",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1369",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1370",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1371",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1372",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1373",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1374",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1375",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1376",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1377",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1378",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1379",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1380",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1381",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1382",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1383",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1384",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1385",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1386",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1387",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1388",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1389",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1390",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1391",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1392",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1393",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1394",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1395",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1396",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1397",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1398",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1399",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1400",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1401",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1402",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1403",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1404",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1405",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1406",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1407",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1408",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1409",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1410",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1411",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1412",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1413",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1414",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1415",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1416",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1417",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1418",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1419",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1420",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1421",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1422",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1423",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1424",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1425",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1426",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1427",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1428",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1429",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1430",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1431",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1432",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1433",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1434",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1435",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1436",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1437",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1438",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1439",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1440",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1441",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1442",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1443",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1444",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1445",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1446",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1805",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1806",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1807",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1808",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1809",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1810",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1811",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1812",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1813",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1814",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1815",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1816",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1817",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1818",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1819",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1820",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1821",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1822",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1823",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1824",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1825",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1826",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1827",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1828",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1829",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1830",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1831",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1832",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1833",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1834",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1835",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1836",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1837",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1838",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1839",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1840",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1841",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1842",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1843",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1844",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1845",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1846",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1847",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1848",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1849",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1850",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1851",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1852",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1853",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1854",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1855",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1856",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1857",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1858",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1859",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1860",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1861",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1862",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1863",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1864",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1865",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1866",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1867",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1868",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1869",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1870",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1871",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1872",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1873",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1874",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1875",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1876",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1877",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1878",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1879",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1880",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1881",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1882",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1883",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1884",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1885",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1886",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1887",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1888",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1889",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1890",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1891",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1892",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1893",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1894",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1895",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1896",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1897",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1898",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1899",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1900",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1901",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1902",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1903",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1904",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1905",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1906",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1907",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1908",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1909",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1910",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1911",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1912",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1913",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1914",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1915",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1916",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1917",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1918",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1919",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1920",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1921",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1922",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1923",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1924",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00",
          "ignored": "false"
        },
        {
          "sample_id": "1925",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1926",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1927",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00",
          "ignored": "false"
        },
        {
          "sample_id": "1928",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1929",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1930",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00",
          "ignored": "false"
        },
        {
          "sample_id": "1931",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1932",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1933",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00",
          "ignored": "false"
        },
        {
          "sample_id": "1934",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1935",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1936",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00",
          "ignored": "false"
        },
        {
          "sample_id": "1937",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1938",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1939",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00",
          "ignored": "false"
        },
        {
          "sample_id": "1940",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1941",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1942",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00",
          "ignored": "false"
        },
        {
          "sample_id": "1943",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1944",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1945",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00",
          "ignored": "false"
        },
        {
          "sample_id": "1946",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1947",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1948",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00",
          "ignored": "false"
        },
        {
          "sample_id": "1949",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1950",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1951",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00",
          "ignored": "false"
        },
        {
          "sample_id": "1952",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1953",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1954",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00",
          "ignored": "false"
        },
        {
          "sample_id": "1955",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1956",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1957",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00",
          "ignored": "false"
        },
        {
          "sample_id": "1958",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1959",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        },
        {
          "sample_id": "1960",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "line": "unknown",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00",
          "ignored": "false"
        }
      ]
    }
  },
  "pedro": {
    "@xmlns:xsi": "http://www.w3.org/2001/XMLSchema-instance",
    "@xsi:schemaLocation": "/W:/ROBuST/DataDescription/models/pcr/model/pcr_model.xsd",
    "status": "finished",
    "name": "Q-PCR LD (12:12) 17C TOC1",
    "purpose": "Experiment carry out to reparameterize the clock off Succrose",
    "description": "Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.",
    "comments": "Sample time 24h. 24h sample lost for some genotypes",
    "provenance": {
      "site": "Edinburgh",
      "author": "Aurora Pinas-Fernandez",
      "start_date": "2010-06-01"
    },
    "growth_condition": {
      "name": "Entrainment 22C Diurnal",
      "medium": "Agar 1.2% MS 0.5",
      "incubation": "3 hours at 4C",
      "growth_space": "Sanyo",
      "duration": "7",
      "temperature_conditions": {
        "constant_temp": {
          "cycle_length": "24",
          "base_temp": "22"
        }
      },
      "light_conditions": {
        "light_channel": {
          "spectrum": "white",
          "intensity": "60",
          "source": "tube",
          "diurnal_light": {
            "cycle_length": "24",
            "start_time": "0",
            "duration": "12"
          }
        }
      }
    },
    "experimental_condition": {
      "name": "17C LD (12:12) Off Sucrose",
      "medium": "Agar 1.2% MS 0.5",
      "growth_space": "Binder",
      "duration": "6",
      "exp_time_zero": "72",
      "temperature_conditions": {
        "constant_temp": {
          "cycle_length": "24",
          "base_temp": "17"
        }
      },
      "light_conditions": {
        "light_channel": {
          "spectrum": "white",
          "intensity": "60",
          "source": "tube",
          "diurnal_light": {
            "cycle_length": "24",
            "start_time": "0",
            "duration": "12"
          }
        }
      }
    },
    "measurement": {
      "technique": "RT-PCR",
      "equipment": "Robot + Light Cycler 480",
      "parameters": "Primers JF116 & JF117 Cycle: 2 - Roche Parameters-cDNA dil 1/10",
      "description": "JF116-TOC1-F;ATCTTCGCAGAATCCCTGTGATA\nJF117-TOC1-R;GCACCTAGCTTCAAGCACTTTACA"
    },
    "sample_preparation": {
      "method": "Samples were harvested and keeped on RNAlader for some weeks, at 4C and -20C. RNa extraction was done following protocol of GE Health Care-illustra RNAspin 96RNA Isolation kit. Samples were spect with Nanodrop. cDNA synthesis was done with Super Script Vilo kit( Invitrogene) from 1ugr RNA."
    },
    "samples": {
      "sample": [
        {
          "sample_id": "1166",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1167",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1168",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1169",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1170",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1171",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1172",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1173",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1174",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1175",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1176",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1177",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1178",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1179",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1180",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1181",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1182",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1183",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1184",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1185",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1186",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1187",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1188",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1189",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1190",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1191",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1192",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1193",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1194",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1195",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1196",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1197",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1198",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1199",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1200",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1201",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1202",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1203",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1204",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1205",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1206",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1207",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1208",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1209",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1210",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1211",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1212",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1213",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1214",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1215",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1216",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1217",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1218",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1219",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1220",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1221",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1222",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1223",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1224",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1225",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1226",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1227",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1228",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1229",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1230",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1231",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1232",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1233",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1234",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1235",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1236",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1237",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1238",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1239",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1240",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1241",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1242",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1243",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1244",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1245",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1246",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "toc1 -9",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1288",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1289",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1290",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1291",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1292",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1293",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1294",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1295",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1296",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1297",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1298",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1299",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1300",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1301",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1302",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1303",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1304",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1305",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1306",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1307",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1308",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1309",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1310",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1311",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1312",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1313",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1314",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1315",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1316",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1317",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1318",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1319",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1320",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1321",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1322",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1323",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1324",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1325",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1326",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1327",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1328",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1329",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1330",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1331",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1332",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1333",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1334",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1335",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1336",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1337",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1338",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1339",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1340",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1341",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1342",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1343",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1344",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1345",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1346",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1347",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1348",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1349",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1350",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1351",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1352",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1353",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1354",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1355",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1356",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1357",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1358",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1359",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1360",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1361",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1362",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1363",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1364",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1365",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1366",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1367",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1368",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1369",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1370",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1371",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1372",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1373",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1374",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1375",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1376",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1377",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1378",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1379",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1380",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1381",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1382",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1383",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1384",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1385",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1386",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1387",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1388",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1389",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1390",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1391",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1392",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1393",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1394",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1395",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1396",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1397",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1398",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1399",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1400",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1401",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1402",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1403",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1404",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1405",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1406",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1407",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1408",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1409",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1410",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1411",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1412",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1413",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1414",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1415",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1416",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1417",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1418",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1419",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1420",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1421",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1422",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1423",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1424",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1425",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1426",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1427",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1428",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1429",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1430",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1431",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1432",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1433",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1434",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1435",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1436",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1437",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1438",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1439",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1440",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1441",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1442",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1443",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1444",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1445",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1446",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Wasilewski (WS)",
            "genotype": "lhy-21 cca1 gi-11",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1805",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1806",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1807",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1808",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1809",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1810",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1811",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1812",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1813",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1814",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1815",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1816",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1817",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1818",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1819",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1820",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1821",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1822",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1823",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1824",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1825",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1826",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1827",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1828",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1829",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1830",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1831",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1832",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1833",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1834",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1835",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1836",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1837",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1838",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1839",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1840",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1841",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1842",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1843",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "Wild Type",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1844",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1845",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1846",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1847",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1848",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1849",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1850",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1851",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1852",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1853",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1854",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1855",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1856",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1857",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1858",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1859",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1860",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1861",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1862",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1863",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1864",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1865",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1866",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1867",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1868",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1869",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1870",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1871",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1872",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1873",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1874",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1875",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1876",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1877",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1878",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1879",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1880",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1881",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1882",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1883",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1884",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1885",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1886",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1887",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1888",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1889",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1890",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1891",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1892",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1893",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1894",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1895",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1896",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1897",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1898",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1899",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1900",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1901",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1902",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1903",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1904",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1905",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1906",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1907",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1908",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1909",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1910",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1911",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1912",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1913",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1914",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1915",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1916",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1917",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1918",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1919",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1920",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1921",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1922",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1923",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1924",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "0.00"
        },
        {
          "sample_id": "1925",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1926",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1927",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "2.00"
        },
        {
          "sample_id": "1928",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1929",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1930",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "4.00"
        },
        {
          "sample_id": "1931",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1932",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1933",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "6.00"
        },
        {
          "sample_id": "1934",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1935",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1936",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "8.00"
        },
        {
          "sample_id": "1937",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1938",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1939",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "10.00"
        },
        {
          "sample_id": "1940",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1941",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1942",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "12.00"
        },
        {
          "sample_id": "1943",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1944",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1945",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "14.00"
        },
        {
          "sample_id": "1946",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1947",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1948",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "16.00"
        },
        {
          "sample_id": "1949",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1950",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1951",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "18.00"
        },
        {
          "sample_id": "1952",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1953",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1954",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "20.00"
        },
        {
          "sample_id": "1955",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1956",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1957",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "22.00"
        },
        {
          "sample_id": "1958",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1959",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        },
        {
          "sample_id": "1960",
          "sample_type": "RNA extract",
          "origin": "whole seedling",
          "growth_stage": "seedling",
          "age": "13",
          "genetic_info": {
            "species": "Arabidopsis thaliana",
            "background": "Columbia (Col)",
            "genotype": "prr7-3 prr9-1",
            "provenance": "Robust Stock"
          },
          "marker": "TOC1",
          "growth_cond_name": "Entrainment 22C Diurnal",
          "experiment_cond_name": "17C LD (12:12) Off Sucrose",
          "collection_time": "24.00"
        }
      ]
    }
  },
  "biblio": {
    "principal": "Karen Halliday",
    "institution": "University of Edinburgh",
    "author": "Aurora Pinas-Fernandez",
    "curator": [
      "Julia Foreman",
      "Andrew Millar"
    ]
  }
}
help Creators and Submitter
Creators
Not specified
Additional credit

Aurora Pinas-Fernandez

Submitter
Activity

Views: 586   Downloads: 109

Created: 18th Jun 2026 at 11:32

Last updated: 1st Sep 2026 at 10:14

help Tags

This item has not yet been tagged.

help Attributions

None

Version History

Version 1 (earliest) Created 18th Jun 2026 at 11:32 by Daniel Thedie

No revision comments

Powered by
(v.1.18.2)