S.pneumoniae D39 cells (wild type and delta greA) were grown in C+Y medium and cells were harvested for total RNA isolation at mid-exponential growth (OD600nm 0.3 for wt, 0.25 for delta greA). Total RNA was isolated as described before (Kloosterman et al 2006). The total RNA samples were examined by capillary electrophoresis. dephosphorylated with antarctic phosphatase followed by treatment with polynucleotide kinase (PNK). Afterwards, samples were poly(A)-tailed using poly(A) polymerase. Then a RNA adapter was ligated to the 5´-phosphate of the RNA fragments. First-strand cDNA synthesis was performed using an oligo(dT)-adapter primer and the M-MLV reverse transcriptase. The resulting cDNAs were PCRamplified to about 30 ng/μl using a high fidelity DNA polymerase. PCR cycles performed and barcode sequences, which are part of the 3' TruSeq sequencing adapter, are included in Table 2. The cDNAs were purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics) and analyzed by capillary electrophoresis. For Illumina sequencing, the cDNA in the size range of 300 - 500 bp was eluted from preparative agarose gels. Aliquots of the size fractionated cDNA were analyzed by capillary electrophoresis. The cDNAs are double stranded and have a size of about 300 – 500 bp. The primers used for PCR amplification were designed for TruSeq sequencing according to the instructions of Illumina. The following adapter sequences flank the cDNA inserts: TrueSeq_Sense_primer 5´- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ TrueSeq_Antisense_primer Barcode 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNN-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC(dT25)-3’ The combined length of the flanking sequences is 146 bases. Properties of cDNA samples No. 1 2 Sample WT greA Barcode ATCACG CGATGT PCR cycles 12 12
For sequencing, the two cDNA samples were pooled in approximately equimolar amounts.The cDNA pool was then sequenced on a Illumina HiSeq 2000 system.
WT 110901_SN865_B_L006_R1_GQC-28- ATCACG.fastq.gz 100 19.624.852 1,29 greA 110901_SN865_B_L006_R1_GQC-28- CGATGT.fastq.gz 100 20.632.085 1,31
llumina fastq format 4 lines for each sequence: 1- Unique identifier, with the following format: @::::#/ 2- Sequence (A, T, C ,G or N (undetermined) only) 3- Orientation (always forward without mapping) 4- Quality value for each base, corresponding to a Phred-like score encoded in ASCII format, with an offset of of 33 (e.g. “J” gives a value of 41) and is in accordance with sanger FASTQ format. The sequence file is compressed as tar.gz archive. The archive can be uncompressed using a tar -zxvf command.
SEEK ID: https://fairdomhub.org/assays/143
Experimental assay
Projects: Noisy-Strep
Investigation: Wetlab approach to transcription fidelity
Assay position:
Assay type: Transcriptomics
Technology type: Technology Type
Organisms: No organisms
Creators and SubmitterCreators
Not specifiedSubmitter
Views: 4508
Created: 23rd Nov 2011 at 15:57
Last updated: 8th Nov 2017 at 14:21
TagsThis item has not yet been tagged.
Download