| Property | Value |
|---|---|
| BioDare ID | 13228298288040 |
| Author | Locke |
| Institution | University of Warwick |
| License |
Literature data from: 'Extension of a genetic network model by iterative experimentation and mathematical analysis.' by: Locke.
First, heroic large-scale RNA profile screen by real-time qPCR in 96-well format, by Megan Southern in 2005. Data are noisy (especially TOC1, FT, CO, parts of ELF3) in part due to much manual pipetting. Experiment 1 of 4.
Testing effects of clock gene mutants in Ws (lhy;cca1, elf4-1, elf3-4) and C24 (toc1-2, tic-1) accessions, on clock gene RNA profiles, in order to identify hypothetical Y in Locke 2005 model.
curated by Andrew Millar, 2011
Samples of 150 ml packed volume of seedlings were harvested into RNAlater buffer (Ambion, Huntingdon, UK) to stabilise RNAs. Seedling harvesting was actually offset by about 10 minutes from first to last sample at each timepoint. First sample always harvested at the marked time, other samples later. Genotype order of harvest was always elf3, elf4, tic, toc1, 2CAC (=C24 WT), lhy;cca1, Ws WT.
Seedlings were homogenised in RLT buffer (Qiagen, Crawley, UK) using a MixerMill MM300 at a frequency of 30 s1 for 3 min with a 5mm stainless steel cone ball (Retsch, Leeds, UK). Total RNA was isolated using a Plant RNeasy kit and RNase-free DNase (Qiagen, Crawley, UK) according to the manufacturer’s instructions. A 1 mg portion of total RNA was reverse-transcribed using the RevertAid cDNA kit (Fermentas, Helena Biosciences, Sunderland, UK) with random hexamer primers, according to the manufacturer’s instructions.
RT-PCR (ABI PRISM 7700 (Applied Biosystems, Warrington, UK), located at HRI Wellesbourne.)
Literature data from: '' by: .
The following primers were used for the paper, each at 300 nM. Other primer sequences in Megan Southern PhD thesis.
GI forward primer AATTCAGCACGCGCCTATTG, GI reverse primer GTTGCTTCTGCTGCAGGAACTT; ACT2 forward primer CAGTGTCTGGATCGGAGGAT, ACT2 reverse primer TGAACAATCGATGGACCTGA
ABI SYBRgreen PCR Mixin a final volume of 15 ml. clock RNA abundance was normalised relative to ACTIN2 (ACT2), using a cDNA dilution series for each primer set in each experiment. Each RNA sample was assayed in triplicate. This upload is one of two independent biological replicates, the other is uploaded separately.
Normalisation between WS and C24 was necessary, as ACT2 detection levels on average were 4x greater in Ws than in C24. Therefore all GoI/ACT2 ratios were multiplied by the average level of ACT2 for that genotype in that experiment.
Growth on Agar 1.5% MS 1 3% Sucrose for 5.0 days (12hR:12hD). need to find red light source, intensity was 13–20 umol.m-2.s-1
| Type | Duration (days) | Cycle (h) | Start | Duration | Spectrum | Source | Intensity |
|---|---|---|---|---|---|---|---|
| diurnal light | 5 | 24 | 0:00 | 12:00 | red | LED | 16 |
| Type | Duration (days) | Cycle (h) | Base (°C) | Warm (°C) | Warm start | Warm duration |
|---|---|---|---|---|---|---|
| constant temperature | 5 | 24 | 22 | -- | -- | -- |
Growth on Agar 1.5% MS 1 3% Sucrose for 5.0 days (12hR:12hD; RR). need to find red light source, intensity was 13–20 umol.m-2.s-1
| Type | Duration (days) | Cycle (h) | Start | Duration | Spectrum | Source | Intensity |
|---|---|---|---|---|---|---|---|
| diurnal light | 1 | 24 | 0:00 | 12:00 | red | LED | 16 |
| constant light | 4 | 24 | 0:00 | 24:00 | red | LED | 16 |
| Type | Duration (days) | Cycle (h) | Base (°C) | Warm (°C) | Warm start | Warm duration |
|---|---|---|---|---|---|---|
| constant temperature | 5 | 24 | 22 | -- | -- | -- |