{ "id": "12820611319996", "status": "finished", "provenance": { "desc_version": "4", "data_version": "1", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-08-17T17:05:31" }, "modified": [ { "by": "Karen Haliday", "date": "2015-10-18T02:15:34", "version": "4.1" }, { "by": "Karen Haliday", "date": "2015-10-18T02:15:16", "version": "4.1" }, { "by": "SYSTEM USER", "date": "2014-09-15T16:54:21" }, { "by": "SYSTEM USER", "date": "2014-09-08T18:30:49" }, { "by": "Jayne Griffiths", "date": "2011-12-02T11:36:46" }, { "by": "Jayne Griffiths", "date": "2011-12-02T11:36:32" }, { "by": "Karen Haliday", "date": "2011-12-01T15:24:09" }, { "by": "Tomasz Zielinski", "date": "2011-05-10T19:17:04" }, { "by": "Aurora Pinas-Fernandez", "date": "2011-01-13T16:11:31" }, { "by": "Aurora Pinas-Fernandez", "date": "2010-11-03T14:27:08" }, { "by": "Aurora Pinas-Fernandez", "date": "2010-11-02T16:12:47" }, { "by": "Aurora Pinas-Fernandez", "date": "2010-10-12T13:33:41" }, { "by": "Aurora Pinas-Fernandez", "date": "2010-10-11T13:38:39" }, { "by": "Aurora Pinas-Fernandez", "date": "2010-10-11T13:38:26" }, { "by": "Aurora Pinas-Fernandez", "date": "2010-10-11T13:37:59" }, { "by": "Aurora Pinas-Fernandez", "date": "2010-08-17T17:05:32" } ] }, "description_file": { "id": "0", "file_type": "description file", "original_name": "description file", "version": [ { "id": "4", "file_type": "description file", "content_type": "text/xml", "original_name": "description file", "local_name": "12820611319996_dsc.4.xml", "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611319996/12820611319996_dsc.4.xml", "uploaded": { "by": "Jayne Griffiths", "date": "2011-12-02T11:36:46" } }, { "id": "3", "file_type": "description file", "content_type": "text/xml", "original_name": "description file", "local_name": "12820611319996_dsc.3.xml", "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611319996/12820611319996_dsc.3.xml", "uploaded": { "by": "Jayne Griffiths", "date": "2011-12-02T11:36:32" } }, { "id": "2", "file_type": "description file", "content_type": "text/xml", "original_name": "description file", "local_name": "12820611319996_dsc.2.xml", "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611319996/12820611319996_dsc.2.xml", "uploaded": { "by": "Tomasz Zielinski", "date": "2011-05-10T19:17:04" } }, { "id": "1", "file_type": "description file", "content_type": "text/xml", "original_name": "description file", "local_name": "12820611319996_dsc.1.xml", "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611319996/12820611319996_dsc.1.xml", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2011-01-13T16:11:31" } }, { "id": "0", "file_type": "description file", "content_type": "text/xml", "original_name": "description file", "local_name": "12820611319996_dsc.xml", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/12820611319996_dsc.xml", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-08-17T17:05:32" } } ] }, "pedro_file": { "id": "0", "file_type": "pedro file", "original_name": "pedro file", "version": [ { "id": "2", "file_type": "pedro file", "content_type": "text/xml", "original_name": "QPCR LD 12-12 PRR7.xml", "local_name": "QPCR LD 12-12 PRR7.xml", "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611319996/QPCR LD 12-12 PRR7.xml", "uploaded": { "by": "Jayne Griffiths", "date": "2011-12-02T11:36:32", "version": "3" } }, { "id": "1", "file_type": "pedro file", "content_type": "application/octet-stream", "original_name": "prr7-17C-LD-OffSuc.xml", "local_name": "prr7-17C-LD-OffSuc.1.xml", "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611319996/prr7-17C-LD-OffSuc.1.xml", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2011-01-13T16:11:31", "version": "2" } }, { "id": "0", "file_type": "pedro file", "content_type": "application/octet-stream", "original_name": "prr7-17C-LD-OffSuc.xml", "local_name": "prr7-17C-LD-OffSuc.xml", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/prr7-17C-LD-OffSuc.xml", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-08-17T17:05:32", "version": "1" } } ] }, "bibliographyFile": { "id": "0", "file_type": "BIBLIOGRAPHY", "original_name": "12820611319996_bibl.xml", "version": { "id": "4", "file_type": "BIBLIOGRAPHY", "content_type": "text/plain", "original_name": "12820611319996_bibl.xml", "local_name": "12820611319996_bibl.xml", "local_path": "/localdisk/data/biodare/biodare3_prod/Robust/Storage/12820611319996/12820611319996_bibl.xml", "uploaded": { "by": "Karen Haliday", "date": "2015-10-18T02:15:16", "version": "4" } } }, "data_file": { "id": "0", "file_type": "data file", "original_name": "2011-12 PRR7 LD.xls", "version": { "id": "0", "file_type": "data file", "content_type": "application/octet-stream", "original_name": "2011-12 PRR7 LD.xls", "local_name": "2011-12 PRR7 LD.xls", "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611319996/2011-12 PRR7 LD.xls", "uploaded": { "by": "Jayne Griffiths", "date": "2011-12-02T11:36:46", "version": "1" }, "parameter": [ { "name": "reference_col", "value": "2" }, { "name": "first_data_row", "value": "2" }, { "name": "main_data_col", "value": "8" } ] } }, "std_raw_file": { "id": "0", "file_type": "data file", "original_name": "STANDARD_RAWDATAFILE.txt", "version": { "id": "0", "file_type": "data file", "content_type": "text/plain", "original_name": "STANDARD_RAWDATAFILE.txt", "local_name": "STANDARD_RAWDATAFILE.txt", "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611319996/STANDARD_RAWDATAFILE.txt", "uploaded": { "by": "Jayne Griffiths", "date": "2011-12-02T11:36:46" }, "parameter": [ { "name": "reference_col", "value": "2" }, { "name": "first_data_row", "value": "2" }, { "name": "main_data_col", "value": "8" } ] } }, "numeric_file": { "id": "0", "file_type": "data file", "original_name": "STANDARD_DATAFILE.txt", "version": { "id": "0", "file_type": "data file", "content_type": "text/plain", "original_name": "STANDARD_DATAFILE.txt", "local_name": "STANDARD_DATAFILE.txt", "local_path": "/disk/data/robust/prod-biodare/Robust/Storage/12820611319996/STANDARD_DATAFILE.txt", "uploaded": { "by": "Jayne Griffiths", "date": "2011-12-02T11:36:46" }, "parameter": [ { "name": "reference_col", "value": "2" }, { "name": "first_data_row", "value": "2" }, { "name": "main_data_col", "value": "8" } ] } }, "user_file": [ { "id": "0", "file_type": "user file", "original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls", "version": [ { "id": "1", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls", "local_name": "17C-LD-OS-wt-prr-gi-lc-toc.1.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/17C-LD-OS-wt-prr-gi-lc-toc.1.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-10-12T13:33:41" } }, { "id": "0", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls", "local_name": "17C-LD-OS-wt-prr-gi-lc-toc.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/17C-LD-OS-wt-prr-gi-lc-toc.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-10-11T13:37:59" } } ] }, { "id": "1", "file_type": "user file", "original_name": "Plt15&16-PRR7-190710-Prog1.xls", "version": { "id": "0", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "Plt15&16-PRR7-190710-Prog1.xls", "local_name": "Plt15&16-PRR7-190710-Prog1.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/Plt15&16-PRR7-190710-Prog1.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-10-11T13:38:26" } } }, { "id": "2", "file_type": "user file", "original_name": "Plt17-PRR7-260710-Prog.xls", "version": { "id": "0", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "Plt17-PRR7-260710-Prog.xls", "local_name": "Plt17-PRR7-260710-Prog.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/Plt17-PRR7-260710-Prog.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-10-11T13:38:26" } } }, { "id": "3", "file_type": "user file", "original_name": "Plt18-PRR7-080810-Prog.xls", "version": { "id": "0", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "Plt18-PRR7-080810-Prog.xls", "local_name": "Plt18-PRR7-080810-Prog.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/Plt18-PRR7-080810-Prog.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-10-11T13:38:26" } } }, { "id": "4", "file_type": "user file", "original_name": "Plt19&20-PRR7-050810-Prog.xls", "version": { "id": "0", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "Plt19&20-PRR7-050810-Prog.xls", "local_name": "Plt19&20-PRR7-050810-Prog.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/Plt19&20-PRR7-050810-Prog.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-10-11T13:38:39" } } }, { "id": "5", "file_type": "user file", "original_name": "Plt21-PRR7-190810-Prog.xls", "version": { "id": "0", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "Plt21-PRR7-190810-Prog.xls", "local_name": "Plt21-PRR7-190810-Prog.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/Plt21-PRR7-190810-Prog.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-10-11T13:38:39" } } }, { "id": "6", "file_type": "user file", "original_name": "17C-LD-OS-wt-cca1.xls", "version": { "id": "0", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "17C-LD-OS-wt-cca1.xls", "local_name": "17C-LD-OS-wt-cca1.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/17C-LD-OS-wt-cca1.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-11-02T16:12:47" } } }, { "id": "7", "file_type": "user file", "original_name": "17C-LD-OS-wt-lhy21.xls", "version": { "id": "0", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "17C-LD-OS-wt-lhy21.xls", "local_name": "17C-LD-OS-wt-lhy21.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/17C-LD-OS-wt-lhy21.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-11-02T16:12:47" } } }, { "id": "8", "file_type": "user file", "original_name": "17C-LD-OS-lhyccagi.xls", "version": { "id": "0", "file_type": "data file", "content_type": "application/vnd.ms-excel", "original_name": "17C-LD-OS-lhyccagi.xls", "local_name": "17C-LD-OS-lhyccagi.xls", "local_path": "/disk/data/robust/tzielins/rep/Robust/Storage/12820611319996/17C-LD-OS-lhyccagi.xls", "uploaded": { "by": "Aurora Pinas-Fernandez", "date": "2010-11-03T14:27:08" } } } ], "security": { "owner": "jgriffiths", "supervisor": "karen", "allowedToRead": [ "halliday", "robust", "public" ] }, "open_access_info": { "grantedBy": "karen", "grantedOn": "2015-10-18T02:15:34", "licence": "CC_BY" }, "desc": { "experiment_type": "qPCR on Robot", "id": "12820611319996", "status": "finished", "name": "Q-PCR LD (12:12) 17C PRR7", "purpose": "Experiment carry out to reparameterize the clock off Succrose", "description": "Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.", "comments": "Sample time 24h. 24h sample lost for some genotypes", "provenance": { "site": "Edinburgh", "author": "Aurora Pinas-Fernandez", "start_date": "2010-06-01" }, "growth_condition": { "name": "Entrainment 22C Diurnal", "medium": "Agar 1.2% MS 0.5", "incubation": "3 hours at 4C", "growth_space": "Sanyo", "duration": "7.0", "temperature_conditions": { "label": "const. 22.0C", "env_conditions": { "type": "constant_temp", "label": "const. 22.0C", "duration": "7", "env_day": { "type": "constant_temp", "label": "constant temperature", "duration": "7", "cycle_length": "24", "base_value": "22.0", "second_value": "22.0" } } }, "light_conditions": { "label": "W: LD 12:00:12:00", "light_channel": { "spectrum": "white", "intensity": "60", "source": "tube", "env_conditions": { "type": "diurnal_light", "label": "LD 12:00:12:00", "duration": "7", "env_day": { "type": "diurnal_light", "label": "diurnal light", "duration": "7", "cycle_length": "24", "base_value": "0.0", "second_value": "100.0", "env_period": { "start_time": "0:00", "duration": "12:00" } } } } } }, "experimental_condition": { "name": "17C LD (12:12) Off Sucrose", "medium": "Agar 1.2% MS 0.5", "growth_space": "Binder", "duration": "6.0", "exp_time_zero": "72", "temperature_conditions": { "label": "const. 17.0C", "env_conditions": { "type": "constant_temp", "label": "const. 17.0C", "duration": "6", "env_day": { "type": "constant_temp", "label": "constant temperature", "duration": "6", "cycle_length": "24", "base_value": "17.0", "second_value": "17.0" } } }, "light_conditions": { "label": "W: LD 12:00:12:00", "light_channel": { "spectrum": "white", "intensity": "60", "source": "tube", "env_conditions": { "type": "diurnal_light", "label": "LD 12:00:12:00", "duration": "6", "env_day": { "type": "diurnal_light", "label": "diurnal light", "duration": "6", "cycle_length": "24", "base_value": "0.0", "second_value": "100.0", "env_period": { "start_time": "0:00", "duration": "12:00" } } } } } }, "measurement": { "technique": "RT-PCR", "equipment": "Robot + Light Cycler 480", "parameters": "Primers JF304 & JF305 Cycle: 2 - Roche Parameters-cDNA dil 1/10", "description": "JF304-PRR7-F;CTTTCTCAAGGTATAATCCAGCC\nJF305-PRR7-R:ACAATCATATGCTGCTTCAGTC", "param": [ { "@name": "RD reference_col", "@value": "2" }, { "@name": "RD first_data_row", "@value": "2" }, { "@name": "RD main_data_col", "@value": "8" } ] }, "sample_preparation": { "method": "Samples were harvested and keeped on RNAlader for some weeks, at 4C and -20C. RNa extraction was done following protocol of GE Health Care-illustra RNAspin 96RNA Isolation kit. Samples were spect with Nanodrop. cDNA synthesis was done with Super Script Vilo kit( Invitrogene) from 1ugr RNA." }, "samples": { "sample": [ { "sample_id": "1166", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1167", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1168", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1169", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1170", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1171", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1172", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1173", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1174", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1175", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1176", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1177", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1178", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1179", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1180", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1181", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1182", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1183", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1184", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1185", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1186", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1187", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1188", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1189", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1190", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1191", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1192", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1193", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1194", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1195", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1196", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1197", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1198", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1199", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1200", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1201", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1202", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1203", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1204", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1205", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1206", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1207", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1208", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1209", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1210", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1211", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1212", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1213", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1214", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1215", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1216", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1217", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1218", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1219", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1220", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1221", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1222", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1223", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1224", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1225", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1226", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1227", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1228", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1229", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1230", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1231", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1232", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1233", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1234", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1235", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1236", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1237", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1238", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1239", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1240", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1241", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1242", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1243", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1244", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1245", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1246", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1288", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1289", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1290", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1291", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1292", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1293", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1294", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1295", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1296", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1297", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1298", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1299", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1300", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1301", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1302", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1303", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1304", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1305", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1306", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1307", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1308", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1309", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1310", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1311", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1312", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1313", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1314", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1315", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1316", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1317", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1318", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1319", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1320", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1321", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1322", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1323", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1324", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1325", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1326", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1327", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1328", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1329", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1330", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1331", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1332", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1333", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1334", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1335", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1336", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1337", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1338", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1339", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1340", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1341", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1342", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1343", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1344", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1345", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1346", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1347", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1348", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1349", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1350", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1351", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1352", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1353", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1354", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1355", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1356", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1357", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1358", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1359", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1360", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1361", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1362", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1363", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1364", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1365", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1366", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1367", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1368", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1369", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1370", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1371", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1372", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1373", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1374", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1375", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1376", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1377", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1378", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1379", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1380", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1381", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1382", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1383", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1384", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1385", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1386", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1387", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1388", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1389", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1390", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1391", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1392", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1393", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1394", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1395", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1396", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1397", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1398", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1399", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1400", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1401", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1402", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1403", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1404", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1405", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1406", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1407", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1408", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1409", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1410", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1411", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1412", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1413", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1414", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1415", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1416", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1417", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1418", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1419", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1420", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1421", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1422", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1423", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1424", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1425", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1426", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1427", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1428", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1429", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1430", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1431", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1432", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1433", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1434", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1435", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1436", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1437", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1438", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1439", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1440", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1441", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1442", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1443", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1444", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1445", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1446", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1805", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1806", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1807", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1808", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1809", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1810", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1811", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1812", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1813", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1814", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1815", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1816", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1817", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1818", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1819", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1820", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1821", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1822", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1823", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1824", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1825", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1826", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1827", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1828", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1829", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1830", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1831", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1832", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1833", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1834", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1835", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1836", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1837", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1838", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1839", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1840", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1841", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1842", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1843", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1844", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1845", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1846", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1847", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1848", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1849", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1850", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1851", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1852", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1853", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1854", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1855", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1856", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1857", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1858", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1859", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1860", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1861", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1862", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1863", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1864", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1865", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1866", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1867", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1868", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1869", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1870", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1871", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1872", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1873", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1874", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1875", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1876", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1877", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1878", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1879", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1880", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1881", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1882", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1883", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1884", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1885", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1886", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1887", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1888", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1889", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1890", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1891", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1892", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1893", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1894", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1895", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1896", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1897", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1898", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1899", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1900", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1901", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1902", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1903", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1904", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1905", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1906", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1907", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1908", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1909", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1910", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1911", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1912", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1913", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1914", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1915", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1916", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1917", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1918", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1919", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1920", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1921", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1922", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1923", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1924", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00", "ignored": "false" }, { "sample_id": "1925", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1926", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1927", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00", "ignored": "false" }, { "sample_id": "1928", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1929", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1930", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00", "ignored": "false" }, { "sample_id": "1931", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1932", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1933", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00", "ignored": "false" }, { "sample_id": "1934", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1935", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1936", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00", "ignored": "false" }, { "sample_id": "1937", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1938", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1939", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00", "ignored": "false" }, { "sample_id": "1940", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1941", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1942", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00", "ignored": "false" }, { "sample_id": "1943", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1944", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1945", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00", "ignored": "false" }, { "sample_id": "1946", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1947", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1948", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00", "ignored": "false" }, { "sample_id": "1949", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1950", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1951", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00", "ignored": "false" }, { "sample_id": "1952", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1953", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1954", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00", "ignored": "false" }, { "sample_id": "1955", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1956", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1957", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00", "ignored": "false" }, { "sample_id": "1958", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1959", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" }, { "sample_id": "1960", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "line": "unknown", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00", "ignored": "false" } ] } }, "pedro": { "@xmlns:xsi": "http://www.w3.org/2001/XMLSchema-instance", "@xsi:schemaLocation": "/W:/ROBuST/DataDescription/models/pcr/model/pcr_model.xsd", "status": "finished", "name": "Q-PCR LD (12:12) 17C PRR7", "purpose": "Experiment carry out to reparameterize the clock off Succrose", "description": "Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.", "comments": "Sample time 24h. 24h sample lost for some genotypes", "provenance": { "site": "Edinburgh", "author": "Aurora Pinas-Fernandez", "start_date": "2010-06-01" }, "growth_condition": { "name": "Entrainment 22C Diurnal", "medium": "Agar 1.2% MS 0.5", "incubation": "3 hours at 4C", "growth_space": "Sanyo", "duration": "7", "temperature_conditions": { "constant_temp": { "cycle_length": "24", "base_temp": "22" } }, "light_conditions": { "light_channel": { "spectrum": "white", "intensity": "60", "source": "tube", "diurnal_light": { "cycle_length": "24", "start_time": "0", "duration": "12" } } } }, "experimental_condition": { "name": "17C LD (12:12) Off Sucrose", "medium": "Agar 1.2% MS 0.5", "growth_space": "Binder", "duration": "6", "exp_time_zero": "72", "temperature_conditions": { "constant_temp": { "cycle_length": "24", "base_temp": "17" } }, "light_conditions": { "light_channel": { "spectrum": "white", "intensity": "60", "source": "tube", "diurnal_light": { "cycle_length": "24", "start_time": "0", "duration": "12" } } } }, "measurement": { "technique": "RT-PCR", "equipment": "Robot + Light Cycler 480", "parameters": "Primers JF304 & JF305 Cycle: 2 - Roche Parameters-cDNA dil 1/10", "description": "JF304-PRR7-F;CTTTCTCAAGGTATAATCCAGCC\nJF305-PRR7-R:ACAATCATATGCTGCTTCAGTC" }, "sample_preparation": { "method": "Samples were harvested and keeped on RNAlader for some weeks, at 4C and -20C. RNa extraction was done following protocol of GE Health Care-illustra RNAspin 96RNA Isolation kit. Samples were spect with Nanodrop. cDNA synthesis was done with Super Script Vilo kit( Invitrogene) from 1ugr RNA." }, "samples": { "sample": [ { "sample_id": "1166", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1167", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1168", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1169", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1170", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1171", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1172", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1173", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1174", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1175", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1176", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1177", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1178", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1179", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1180", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1181", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1182", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1183", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1184", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1185", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1186", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1187", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1188", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1189", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1190", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1191", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1192", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1193", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1194", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1195", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1196", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1197", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1198", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1199", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1200", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1201", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1202", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1203", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1204", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1205", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1206", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1207", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1208", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1209", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1210", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1211", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1212", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1213", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1214", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1215", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1216", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1217", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1218", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1219", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1220", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1221", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1222", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1223", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1224", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1225", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1226", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1227", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1228", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1229", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1230", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1231", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1232", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1233", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1234", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1235", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1236", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1237", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1238", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1239", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1240", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1241", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1242", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1243", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1244", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1245", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1246", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "toc1 -9", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1288", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1289", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1290", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1291", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1292", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1293", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1294", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1295", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1296", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1297", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1298", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1299", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1300", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1301", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1302", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1303", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1304", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1305", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1306", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1307", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1308", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1309", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1310", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1311", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1312", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1313", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1314", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1315", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1316", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1317", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1318", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1319", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1320", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1321", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1322", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1323", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1324", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1325", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1326", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1327", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1328", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1329", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1330", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1331", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1332", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1333", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1334", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1335", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1336", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1337", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1338", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1339", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1340", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1341", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1342", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1343", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1344", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1345", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1346", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1347", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1348", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1349", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1350", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1351", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1352", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1353", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1354", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1355", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1356", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1357", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1358", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1359", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1360", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1361", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1362", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1363", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1364", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1365", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1366", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1367", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1368", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1369", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1370", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1371", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1372", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1373", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1374", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1375", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1376", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1377", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1378", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1379", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1380", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1381", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1382", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1383", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1384", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1385", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1386", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1387", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1388", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1389", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1390", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1391", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1392", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1393", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1394", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1395", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1396", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1397", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1398", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1399", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1400", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1401", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1402", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1403", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1404", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1405", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1406", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1407", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1408", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1409", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1410", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1411", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1412", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1413", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1414", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1415", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1416", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1417", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1418", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1419", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1420", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1421", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1422", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1423", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1424", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1425", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1426", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1427", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1428", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1429", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1430", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1431", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1432", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1433", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1434", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1435", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1436", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1437", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1438", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1439", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1440", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1441", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1442", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1443", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1444", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1445", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1446", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Wasilewski (WS)", "genotype": "lhy-21 cca1 gi-11", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1805", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1806", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1807", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1808", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1809", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1810", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1811", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1812", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1813", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1814", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1815", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1816", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1817", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1818", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1819", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1820", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1821", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1822", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1823", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1824", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1825", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1826", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1827", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1828", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1829", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1830", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1831", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1832", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1833", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1834", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1835", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1836", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1837", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1838", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1839", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1840", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1841", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1842", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1843", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "Wild Type", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1844", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1845", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1846", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1847", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1848", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1849", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1850", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1851", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1852", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1853", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1854", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1855", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1856", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1857", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1858", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1859", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1860", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1861", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1862", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1863", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1864", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1865", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1866", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1867", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1868", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1869", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1870", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1871", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1872", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1873", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1874", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1875", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1876", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1877", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1878", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1879", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1880", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1881", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1882", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1883", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1884", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1885", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1886", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1887", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1888", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1889", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1890", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1891", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1892", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1893", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1894", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1895", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1896", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1897", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1898", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1899", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1900", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1901", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1902", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1903", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1904", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1905", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1906", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1907", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1908", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1909", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1910", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1911", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1912", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1913", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1914", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1915", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1916", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1917", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1918", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1919", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1920", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1921", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1922", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1923", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1924", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "0.00" }, { "sample_id": "1925", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1926", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1927", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "2.00" }, { "sample_id": "1928", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1929", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1930", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "4.00" }, { "sample_id": "1931", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1932", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1933", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "6.00" }, { "sample_id": "1934", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1935", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1936", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "8.00" }, { "sample_id": "1937", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1938", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1939", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "10.00" }, { "sample_id": "1940", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1941", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1942", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "12.00" }, { "sample_id": "1943", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1944", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1945", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "14.00" }, { "sample_id": "1946", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1947", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1948", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "16.00" }, { "sample_id": "1949", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1950", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1951", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "18.00" }, { "sample_id": "1952", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1953", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1954", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "20.00" }, { "sample_id": "1955", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1956", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1957", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "22.00" }, { "sample_id": "1958", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1959", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" }, { "sample_id": "1960", "sample_type": "RNA extract", "origin": "whole seedling", "growth_stage": "seedling", "age": "13", "genetic_info": { "species": "Arabidopsis thaliana", "background": "Columbia (Col)", "genotype": "prr7-3 prr9-1", "provenance": "Robust Stock" }, "marker": "PRR7", "growth_cond_name": "Entrainment 22C Diurnal", "experiment_cond_name": "17C LD (12:12) Off Sucrose", "collection_time": "24.00" } ] } }, "biblio": { "principal": "Karen Halliday", "institution": "University of Edinburgh", "author": "Aurora Pinas-Fernandez", "curator": [ "Julia Foreman", "Andrew Millar" ] } }