| Property | Value |
|---|---|
| BioDare ID | 12820610743262 |
| Author | Aurora Pinas-Fernandez |
| Institution | University of Edinburgh |
| License | CC_BY |
Seedlings were entrained for 7 days at 22C in 12:12 white light. Then shifted to 17C 12:12 white light. Samples were collected on the 6th day at 17 degrees.
Experiment carry out to reparameterize the clock off Succrose
Sample time 24h. 24h sample lost for some genotypes
Samples were harvested and keeped on RNAlader for some weeks, at 4C and -20C. RNa extraction was done following protocol of GE Health Care-illustra RNAspin 96RNA Isolation kit. Samples were spect with Nanodrop. cDNA synthesis was done with Super Script Vilo kit( Invitrogene) from 1ugr RNA.
RT-PCR (Robot + Light Cycler 480)
JF309-PRR9-F;GATTGGTGGAATTGACAAGC JF310-PRR9-R;TCCTCAAATCTTGAGAAGGC
Primers JF309 & JF310 Cycle: 2 - Roche Parameters-cDNA dil 1/10
Growth on Agar 1.2% MS 0.5 for 7.0 days (Entrainment 22C Diurnal).
| Type | Duration (days) | Cycle (h) | Start | Duration | Spectrum | Source | Intensity |
|---|---|---|---|---|---|---|---|
| diurnal light | 7 | 24 | 0:00 | 12:00 | white | tube | 60 |
| Type | Duration (days) | Cycle (h) | Base (°C) | Warm (°C) | Warm start | Warm duration |
|---|---|---|---|---|---|---|
| constant temperature | 7 | 24 | 22 | -- | -- | -- |
Growth on Agar 1.2% MS 0.5 for 6.0 days (17C LD (12:12) Off Sucrose).
| Type | Duration (days) | Cycle (h) | Start | Duration | Spectrum | Source | Intensity |
|---|---|---|---|---|---|---|---|
| diurnal light | 6 | 24 | 0:00 | 12:00 | white | tube | 60 |
| Type | Duration (days) | Cycle (h) | Base (°C) | Warm (°C) | Warm start | Warm duration |
|---|---|---|---|---|---|---|
| constant temperature | 6 | 24 | 17 | -- | -- | -- |