C201SC18122416 QC Analysis Report

Novogene Co., Ltd

1.4 Results of Raw Data Filtering

The sequenced reads (raw reads) often contain low quality reads and adapters, which will affect the analysis quality. So it's necessary to filter the raw reads and get the clean reads. The filtering process is as follows:

(1) Remove reads containing adapters.

(2) Remove reads containing N > 10% (N represents the base cannot be determined).

(3) Remove reads containing low quality (Qscore<= 5) base which is over 50% of the total base.

Adapter sequences :

  5' Adapter:

  5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'

  3' Adapter(The underlined 6bp bases is Index):

  5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG-3'

The Sequencing data filtration of this project can be seen in Fig.4 :

• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 
• 

Fig.4 Composition of Raw Data

Different color for different components:

(1)Adapter related: (reads containing adapter) / (total raw reads)

(2)Containing N: (reads with more than 10% N) / (total raw reads)

(3)Low quality: (reads of low quality) / (total raw reads)

(4)Clean reads: (clean reads) / (total raw reads)

Novogene Co., Ltd

2 Summary of Sequencing Data Information

The total output of data on the sequencer: Raw data 143.5 G, and the data filtered from raw data: Clean data 137.5 G.

The detail statistics for the quality of sequencing data are shown in Table 1.

Table 1 Data Quality Summary

Sample: sample name
Raw reads: total amount of reads of raw data, each four lines taken as one unit. For paired-end sequencing, it equals the amount of read1 and read2, otherwise it equals the amount of read1 for single-end sequencing.
Clean reads: total amount of reads of clean data, each four lines taken as one unit. For paired-end sequencing, it means the amount of read1 and read2, otherwise it equals the amount of read1 for single-end sequencing.
Raw bases: (Raw reads) * (sequence length), calculating in G. For paired-end sequencing like PE150, sequencing length equals 150, otherwise it equals 50 for sequencing like SE50.
Clean bases: (Clean reads) * (sequence length), calculating in G. For paired-end sequencing like PE150, sequencing length equals 150, otherwise it equals 50 for sequencing like SE50.
Effective Rate(%): (Clean reads/Raw reads)*100%
Error rate: base error rate
Q20, Q30: (Base count of Phred value > 20 or 30) / (Total base count)
GC content: (G & C base count) / (Total base count)

1. Introduction of Sequencing Data Format

The original data obtained from the high throughput sequencing platforms are transformed to sequenced reads by base calling. Raw data are recorded in a FASTQ file which contains sequenced reads and corresponding sequencing quality information. Every read in FASTQ format is stored in four lines as follows (Cock P.J.A. et al. 2010):

@HWI-ST1276:71:C1162ACXX:1:1101:1208:2458 1:N:0:CGATGT   
NAAGAACACGTTCGGTCACCTCAGCACACTTGTGAATGTCATGGGATCCAT
+
#55???BBBBB?BA@DEEFFCFFHHFFCFFHHHHHHHFAE0ECFFD/AEHH

Line 1 begins with a '@' character and is followed by a sequence identifier and an optional description (such as a FASTA title line).

Line 2 is the sequence of the read.

Line 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again.

Line 4 encodes the quality values for the bases in Line 2.

The details of Illumina sequence identifier are as follows:

Novogene Co., Ltd

2. Explanation of Sequencing Data Related

(1) The data deliverd is a compressed file in format of '.fq.gz'. Before data delivery, we will calculate the md5 value of each compressed file and please check it when you get the data. There are two ways to check the md5 value. In Linux environment, you can use 'md5sum -c <*md5.txt>' command under the data directory. In Windows environment, you can use a calibration tool e.g. hashmyfiles. If the md5 value of compressed file doesn't match with the one we provide in md5 file in data directory, the file may have been damaged during the transmitting procedure.

(2) For paired-end (PE) sequencing, every sample should have 2 data flies (read1 file and read2 file). These 2 files have the same line number, you could use 'wc -l' command to check the line number in Linux environment. The line number divide by 4 is the number of reads.

(3) The date size is the space occupied by the data in the hard disk. It's related to the format of disk and compression ratio. And it has no influence on the quantity of sequenced bases. So the size of read1 file may be unequal to the size of read2 file.

(4) When customer’s samples need large amount of data e.g. whole genome sequencing data, we would use separate-lane sequencing strategy to make sure the quality of data. So it's possible that one sample has several parts sequencing data. For example, if sample 1 has two read1 files, sample1_L1_1.fq.gz and sample1_L2_1.fq.gz, that means this sample was sequenced on different lanes.

(5) About the quality control standard. If we promise to deliver the clean data, we will filter the data strictly according to the standard to obtain high quality clean data which can be used for further research and paper writing. We will discard the paired reads in the following situation: when either one read contains adapter contamination; when either one read contains uncertain nucleotides more than 10 percent; when either one read contains low quality nucleotides (base quality less than 5) more than 50 percent, discard the paired reads. The data analysis results based on this standard can be approved by high level magazines (Yan L.Y. et al . 2013). If you want to get more information, please refer to the official website of Novogene (www.novogene.com).

(6) About the sequenced reads. The Index is normally in the middle of the adapter during the process of experimenting and sequencing except the special library. We can get the Read1 sequence and Read2 sequence by Index read. They are all the sequence of samples so that it's no necessary to dispose the beginning and end of reads in the downstream analysis(e.g. mapping).

(7) Ninety days after the data delivery, we will delete outdated data. So please keep your data properly. If you have any question or doubt, please contact us as soon as possible. Have a nice day!